Main Database, View record [ ID: 10 ]
ID# RP0010 
ID 10 
Sequence GGTCTCTCTGGTTAGACCAGA 
Structure (((([[[:::::::))))]]] 
Organism A04321|HIVLAIJ19 
Notes >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG