Main Database, View record [ ID: 1 ]
ID# RP0001 
ID
Sequence GCTGAGCCAGCAGCAGATGGGGTGG 
Structure ((((::[[[:))))::::::::]]] 
Organism A04321|HIVLAIJ19 
Notes >A04321|HIVLAIJ19 H0001 James F.Lynn 01-06-09 KSNEG:GCTGAGCCAGCAGCAGATGGggtgg ((((..[[[.))))...]]]