Main Database

Page 1 of 23
ID# ID Sequence Structure Organism Notes
RP0001 1 GCTGAGCCAGCAGCAGATGGGGTGG ((((::[[[:))))::::::::]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 H0001 James F.Lynn 01-06-09 KSNEG:GCTGAGCCAGCAGCAGATGGggtgg ...
RP0002 2 AAAGTTGTCCCTTTGACTGACACGAC ((((::[[[:)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 ...
RP0003 3 TCAACTGCTGTTGAATGGCAGTCTAGC ((((::[[[:))))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA James F.Lynn ...
RP0004 4 ATTAAATAAAATAGTAAGAATGTAT (((::[[[:)))::::::::::]]] A07108 HIV >A07108 H0004 James F.Lynn 01-06-09 KSNEG
RP0005 5 ACAAGGAACTGTATCCTTTAACTTC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 ...
RP0006 6 AAGTTGTCCCTTTGACTGACACGAC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn ...
RP0007 7 AGTTGTCACCCTAACTGAC (((([[[:::::))))]]] A04321|HIVLAIJ19 H0007 James F.Lynn 01-08-09 >A04321|HIVLAIJ19 KSNEG
RP0008 8 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A07108 HIV >A07108 (appears twice)Human immunodeficiency virus type 1 (LAV.ELI) proviral D ...
RP0009 9 AAAATCTTAGAGCCTTTTAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 ge ...
RP0010 10 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
RP0011 11 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A07108 HIV >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG
RP0012 12 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
RP0013 13 GCTGCCAGAAAAAGACAGCTGG (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 RSNEG
RP0014 14 GATTGTTTTTCAGAATCTGCTATAAGAAA ((((:::[[[:::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0015 15 AGCCATTACACAGGCTTGTCCAAAGGTA ((((::[[[:::)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn ...
RP0016 16 GGAATTTGGAATTCCCTACAATCCCCA ((((::[[[::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0017 17 GCACCACTAATGTGCCCTGGAACTCTAG ((((::[[[::))))::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0018 18 CAAAGGTATCCTTTGAGCCAATTCCCATA ((((::[[[::)))):::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0021 21 TCCAGAAGCGCTGGAAGGGCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0022 22 TTAACCTCAGAATAAGATTGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0023 23 TCTAGTAGTCATAGACTCACT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0020 20 AAGCATGTCATGTATATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0019 19 CATTCCATTCTGATGATAAAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0027 27 AGAGTGTCTCAATCTGGTAGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0028 28 CCCATGGGGACGGGGTAGCCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0029 29 GCCAGCCGCTCGGGCTCCGCG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0030 30 GAAGGTAACGAATTCTCCGTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0026 26 TGGAAGCCTAAGCCAAGAAGG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0025 25 TTTTGACTTCGTAAAAATAAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0024 24 AGTTAAGTAAAGACTGGTTAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...

Main Database

Page 2 of 23
ID# ID Sequence Structure Organism Notes
RP0033 33 GCATCCCTTTCCTGCATAAAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0034 34 CTTGGATTCGAGAAGACGGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0035 35 GATCATTTCGAGATCTTCGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0032 32 ACACTCTCAACTTGTAGATGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0031 31 GCCGCAAAAGGGGGCCGCTTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0036 36 TCAGAGAAGTTTTGACCGCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0037 37 ATATCAATATTATATATATAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0038 38 ATAGGATTAGATCTTTCTTAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0039 39 GCGTACTATGGATCTCTTACG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0040 40 GACTCTCCTTTCGTCATAAGG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0041 41 CCTTCCAGAACCAGGGGGTCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0042 42 TTATTACTCGACTAAAAGGAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0055 55 CGACTTTGTTCGTCGTGTACA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0043 43 GCTATGAAGCTTAGCCTTCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0044 44 AGAAACGACATCTCTTATGTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0045 45 CTTTTATTCATGAAGAAAGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0046 46 GGAGAGGAGTGATCCAAGCTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0047 47 CTTTCCAATAAGAAGATCATT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0048 48 TCTTTTTTTTGAAGAAAGAAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0049 49 ATTTATCATCAGAATGGAATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0050 50 AACAGACTAGTCGTTCAGTAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0051 51 CAACCGTCTTGATTGAATAGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0052 52 TCTTTCACTATTAGATTCAGT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0053 53 ATATCTATTATTTATAATAAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0054 54 TCTCCTAGAGAAAGAAGTTCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0056 56 CGCTGCCTACACGCGAATTAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0057 57 CTCAATATATACGAGTGTTAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0058 58 ACGTCGGAACCGCGTGAGTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0059 59 GGGGCTGTTAAGCCCAAGAAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0060 60 GACTCCGCGAACGTCCCGCGC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...

Main Database

Page 3 of 23
ID# ID Sequence Structure Organism Notes
RP0061 61 GGCATGATCAAAGCCGATGAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0062 62 GCGGCCCATAGGCGCGAGATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0063 63 CCCACAACCAAAGGGAGTGGT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0064 64 GGGTCCGAGCTTCCCAAGCTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0065 65 TTATCTTTAAGATAATGGTAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0066 66 AAAAAAGGGGGCTTTGTTCCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0067 67 AAATCGGTACACTTTTAGTAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0068 68 CCCCTTGAAGTAGGGGGTTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0069 69 CTTGACTGAGCAAAGAAGTCA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0070 70 TTAATAATCAAATAATAAGAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0071 71 CTTAGGAAGAAAAAGGCTCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0072 72 TTGAAAGAAAGACAAAACTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0073 73 TGTTCCTCGGATACAATTCGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0074 74 CTTTCGGGCGAGAAGCAGGCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0075 75 ACCAGTTCATATTTGGTTACT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0076 76 CGCTGAAACGGAGCGATATCCGT (((::::[[[[[))):::]]]]] X78602 peanut clump virus PKB-number: PKB33
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of ...
RP0077 77 CCCTAACCGCGGGTAAGCGG (((:::[[[[))):::]]]] M25782 satellite tobacco mosaic virus PKB-number: PKB22 Definition: tRNA-like structure 3'end pseudoknot of satellit ...
RP0078 78 CCGTAACCGCCGGTAGCGG (((:::[[[[)))::]]]] M34077 tobacco mild green mosaic virus PKB-number: PKB23 Definition: tRNA-like structure 3'end pseudoknot of tobacco ...
RP0079 79 CCTTTACCCCGGGTATGGGG (((:::[[[[))):::]]]] X72586 paprika mild mottle virus PKB-number: PKB24 Definition: tRNA-like structure 3'end pseudoknot of paprika ...
RP0080 80 GGGGGGACTTAGCGCCCCCCAAACCGT ((((((:::::[[[))))))::::]]] AF033818 Bovine Leukemia Virus PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke ...
RP0101 101 ACTCAGTATTGTGCCTGAGTGATGGCA ((((((:::::[[[))))))::::]]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA12-25-08 Jame ...
RP0102 102 GAGACCTCCAGTGGGTCTCTAGGGGCACACCCACT ((((((:::[[[[))))))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0002 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) ...
RP0103 103 TTTCAGGTGGCGTCTGAAAAGACTCGCCAGACGC ((((((:::[[[[)))))):::::::::::]]]] Bovine Leukemia Virus AF033818 M0003 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) ...
RP0104 104 CCCTGTCAGTGGGGCTCACTG (((:::[[[[)))::::]]]] Bovine Leukemia Virus AF033818 M0004 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[)))::::]] ...
RP0105 105 GGGACCCTGACCCAACAATCAG (((:::[[[[))):::::]]]] Bovine Leukemia Virus AF033818 M0005 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::] ...
RP0106 106 GGTGCGAGAAACCATTCATTCT (((:::[[[[))):::::]]]] Bovine Leukemia Virus AF033818 M0006 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::] ...
RP0113 113 TGCAGGCTTGTGCACATTGGGCCCCCAAG ((((::[[[[)))):::::::::::]]]] Bovine Leukemia Virus AF033818 M0013 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((::[[[[)))):::: ...
RP0112 112 AGACCTCCAGTGGGTCTCTAGGGGCACACCCAC ((((:::::[[[[))))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0012 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((:::::[[[[)))): ...
RP0111 111 AACTGCCCCCTTCCGGCCGTTCGCGCTCAGCCCGGCC (((:::::::::::[[[[)))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0011 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::::::::::[[[[ ...
RP0110 110 GTCGCCCAGAACCGACGGGGGCTTGATTGGTT (((::::::[[[[)))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0010 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((::::::[[[[))):: ...

Main Database

Page 4 of 23
ID# ID Sequence Structure Organism Notes
RP0109 109 TCAGGTGGCGTCTGAAAAGACTCGCCAGACG (((:::::[[[[)))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0009 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::::[[[[)))::: ...
RP0107 107 GGTGGCTAGGACCTCTCCCGGCCCTA (((:::[[[[))):::::::::]]]] Bovine Leukemia Virus AF033818 M0007 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::: ...
RP0108 108 GGTGCGAGAAACCATTCATTCTGTTCT (((:::[[[[)))::::::::::]]]] Bovine Leukemia Virus AF033818 M0008 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::: ...
RP0125 125 ACACATGCCTGTGTACCCACAG (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0025
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0126 126 AATCTGTAGTAATTAATTGTAC (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0026
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0127 127 GATGTATAAATATCACTGCATT (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0027
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0129 129 ATGATAAATACCATAGTAATGTA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0030
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0128 128 ACTTGAAGGAGAGTGAGAGACTC (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0028
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0130 130 CCCCCCTTGGAGGGTATCCAAG (((::[[[[[[)))::]]]]]] D30753 potato mop-top virus PKB-number: PKB32
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of ...
RP0131 131 AAAACTCAAAATTTAAAAATTTT (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0031
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0115 115 TACCAACTTTGTAAAAGAAAAG (((:::[[[[))):::::]]]] AF033820 Equine infectious anemia virus M0015
AF033820 Equine infectious anemia virus
James F. Lynn 12-25-08

(((:: ...
RP0116 116 AAAGAAATAGCTGTCTTTTATCCAG (((((:::::[[[)))))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0016
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0117 117 TTTGTTTCATAACAAAAGCCTTA ((((:::::[[[))))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0017
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0122 122 CAGAGGATTTGCTGCACCTCAA (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0022
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0123 123 AAAACTCAAAATTTAAAAATTT (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0023
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0124 124 TTGTTTCATAACAAAAGCCTTA (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0024
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0114 114 TGGTCCATAACCAGATTGTCACCTAT ((((::[[[))))::::::::::]]] Bovine Leukemia Virus AF033818 M0014Bovine Leukemia Virus AF033818James F. Lynn 12-25-08
RP0118 118 CAATTCTCTCTTTGGAGGAGA (((:::::[[[)))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0019
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0119 119 CAATTCTCTCTTTGGAGGAGA (((:::::[[[)))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0019
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0120 120 AATGGCAGTTCATTGCATGAA (((:::::[[[)))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0020
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0121 121 CCTCCGGTTGCAGGTAAGTGCA (((:::::[[[))):::::]]] AF038398 HIV M0021
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0152 152 CCTAACCCCGGGTAGGGG (((::[[[[)))::]]]] U03387 turnip vein-clearing virus PKB-number: PKB25
Definition: tRNA-like structure 3'end pseudoknot of turnip ...
RP0153 153 CCTAACCCCGGGTAGGGG (((::[[[[)))::]]]] U30944 oilseed rape mosaic virus PKB-number: PKB26
Definition: tRNA-like structure 3'end pseudoknot of oilseed ...
RP0154 154 CCCGAACCGCGGGTAGCGG (((:::[[[[)))::]]]] M81413 pepper mild mottle virus PKB-number: PKB27
Definition: tRNA-like structure 3'end pseudoknot of pepper ...
RP0155 155 CCTTACCTCGGGTAGAGG (((::[[[[)))::]]]] U34586 odontoglossum ringspot virus PKB-number: PKB28
Definition: tRNA-like structure 3'end pseudoknot of odontog ...
RP0156 156 CCTAACCCCGGGTAGGGG (((::[[[[)))::]]]] D38444 tobacco mosaic virus PKB-number: PKB29
Definition: tRNA-like structure 3'end pseudoknot of tobacco ...
RP0157 157 CCCGAACCGGAGGGTTATCCGG (((:::[[[[[))):::]]]]] L07937 soil-borne wheat mosaic virus PKB-number: PKB30
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of ...
RP0158 158 CCCCATCCGGAGGGTTATCCGG (((:::[[[[[))):::]]]]] X81639 soil-borne wheat mosaic virus PKB-number: PKB31 Definition: tRNA-like structure 3'end pseudoknot of RNA2 of ...
RP0159 159 CGCTGAAACGGAGCGATATCCGT (((::::[[[[[))):::]]]]] L07269 peanut clump virus PKB-number: PKB34
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of ...
RP0132 132 ACAGATACTTGTGTTTAATACAA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...

Main Database

Page 5 of 23
ID# ID Sequence Structure Organism Notes
RP0133 133 GTAATTAATTGTACAAGACCCAA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0134 134 ATAGGAGGTTTTATTAATACTAAA (((:::::[[[))):::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0135 135 TACAGAAGTTAGTAGGAGTATTAA (((:::::[[[))):::::::]]] >gi|2828036|gb|AF038398.1|AF03839 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0136 136 AATGCTGATAGATTTTAGGGAACTA (((:::::[[[)))::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0137 137 ACAGTTTTAATTGTGGAGGGGAATT (((:::::[[[)))::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0138 138 ACCAGAAAAAGGGTGGCTCAGTACTT (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0139 139 GGAGCTAATTTTCCAGGTTTGGCAAA (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0140 140 TTTATGGGATGAAAGCCTAAAGCCAT (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0141 141 GTAATTAATTGTACAAGACCCAACAA (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0142 142 GACAATCAGTGGTCTTATAAAATTCAC (((:::::[[[)))::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0143 143 GGACCTCCTCCTCCTCCCCCTCCAGGA (((:::::[[[)))::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0144 144 CACTCTATTTTGTGCATCAGATGCTAAA (((:::::[[[))):::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0145 145 CCAAAGACATTTGGCTGGCTATGGAAAT (((:::::[[[))):::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0146 146 TTGCTGCACCTCAATTCTCTCTTTGGAGG (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0147 147 CTTAGCACTGAAAGTAGTAAGCGATGTCA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0148 148 CCTCCCCCTCCAGGACTAGCATAAATGGA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0149 149 TAACAAAAGCCTTAGGCATCTCCTATGGC (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0150 150 GTAATTAATTGTACAAGACCCAACAACAA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0151 151 TCACTCTCTTGTGAGGGACAGAAATACAA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0160 160 CGCCGATACGGAGCGATATCCGT (((::::[[[[[))):::]]]]] X99149 Indian peanut clump virus PKB-number: PKB35
Definition: tRNA-like structure 3'end pseudoknot of RNA-1 o ...
RP0161 161 CCCTTTACTTGAGGGAAATCAAG (((::::[[[[[))):::]]]]] Z97873 beet soil-borne virus PKB-number: PKB36
Definition: tRNA-like structure 3'end pseudoknot of RNA 1 o ...
RP0162 162 CCCTTAACTTGAGGGAAATCAAG (((::::[[[[[))):::]]]]] U64512 beet soil-borne virus PKB-number: PKB37
Definition: tRNA-like structure 3'end pseudoknot of RNA 2 o ...
RP0163 163 CCCTTAACTAGAGGGAAATCTAG (((::::[[[[[))):::]]]]] Z66493 beet soil-borne virus PKB-number: PKB38
Definition: tRNA-like structure 3'end pseudoknot of RNA 3 o ...
RP0164 164 CCCTAACTTGAGGGAAATCAAG (((:::[[[[[))):::]]]]] AJ223596 beet virus Q PKB-number: PKB39
Definition: tRNA-like structure 3'end pseudoknot of RNA 1 o ...
RP0165 165 CCCTAACTTGAGGGAAATCAAG (((:::[[[[[))):::]]]]] AJ223597 beet virus Q PKB-number: PKB40
Definition: tRNA-like structure 3'end pseudoknot of RNA 2 o ...
RP0166 166 CCCTAACTTGAGGGAAATCAAG (((:::[[[[[))):::]]]]] AJ223598 PKB-number: PKB41
Definition: tRNA-like structure 3'end pseudoknot of RNA 3 o ...
RP0167 167 GCGGCACCGCCCGCCAAAACAAACGG ((((::[[[:)))):::::::::]]] Y07496 potato leafroll virus PKB-number: PKB42
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras ...
RP0168 168 GCGGCACCGTCCGCCAAAACAAACGG ((((::[[[[))))::::::::]]]] D00530 potato leafroll virus PKB-number: PKB43
Definition: ORF2a/ORF2b (putative RNA-dependent RNA polymer ...
RP0170 170 TTCCGGTCGACTCCGGAGAAACAAAGTC ((((((::[[[[))))))::::::]]]] L04573 pea enation mosaic virus PKB-number: PKB45
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras ...
RP0169 169 GGCGGCGGCGACCGCCGAAACAACCGC (((((::[[[:)))))::::::::]]] X76931 cucurbit aphid-borne yellows virus PKB-number: PKB44
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras ...

Main Database

Page 6 of 23
ID# ID Sequence Structure Organism Notes
RP0081 81 CGCGGCACCGTCCGCGGAACAAACGG (((((::[[[[)))))::::::]]]] X13063 Beet Western-Yellows Virus PKB-number: PKB2 Modification: 1999-6-21 Definition: Orf2-orf3 ribosomal f ...
RP0082 82 GGGGCTCAAGGGAGGCCCCAGAAACAAACTTTCCC ((((((:::[[[[))))))::::::::::::]]]] AF033820 Equine Infectious Anemic Virus PKB-number: PKB3 Definition: Gag-pol ribosomal frameshift site of Equine Infec ...
RP0083 83 GGGGCGAGCTGCAGCCCCAGTGAATCAAATGCAGC (((((::[[[[[[))))):::::::::::]]]]]] M25381 Feline Immunodeficiency Virus PKB-number: PKB4 Definition: Gag-pol ribosomal frameshift site of Feline Imm ...
RP0084 84 CCCCTCTTCCGAGGGTCATCGGA (((::::[[[[[))):::]]]]] X16378 turnip yellow mosaic virus PKB-number: PKB5
Definition: tRNA-like structure from turnip yellow mosaic ...
RP0085 85 CGTCTATCCTGGACGTCACCAGGA (((:::[[[[[[))):::]]]]]] AF035199 kennedya yellow mosaic virus PKB-number: PKB6
Definition: tRNA-like structure 3'end pseudoknot of kenned ...
PK0087 87 CCCCCTTCCGTGGGTAACGGAA (((::[[[[[[)))::]]]]]] Y16104 physalis mottle virus PKB-number: PKB8
Definition: tRNA-like structure 3'end pseudoknot of physal ...
PK0086 86 CGTCCTCCCGAACGTCATCGGGA (((::[[[[[[))):::]]]]]] X54354 cacao yellow mosaic virus PKB-number: PKB7 Definition: tRNA-like structure 3'end pseudoknot of cacao y ...
RP0100 100 CCGGAACCCCCGGTTGGGG (((:::[[[[)))::]]]] X02144 tobacco mosaic virus PKB-number: PKB21
Definition: tRNA-like structure 3'end pseudoknot of the tom ...
RP0088 88 CGTCTATCCTGGACGTCACCAGGA (((:::[[[[[[))):::]]]]]] AF035201 desmodium yellow mottle virus PKB-number: PKB9
Definition: tRNA-like structure 3'end pseudoknot of desmodiu ...
RP0089 89 CCCCTTTTCCGAGGGTATCGGAA (((:::[[[[[[)))::]]]]]] J04375 ononis yellow mosaic virus PKB-number: PKB10
Definition: tRNA-like structure 3'end pseudoknot of ononis ...
RP0090 90 CGTCCATCTCGAACGTCATCGAGA (((:::[[[[[[))):::]]]]]] AF035200 clitoria yellow vein virus PKB-number: PKB11
Definition: tRNA-like structure 3'end pseudoknot of clitori ...
RP0091 91 CCTCCCCCCGTAGGTTAACGGG (((:::[[[[[))):::]]]]] AF035633 wild cucumber mosaic virus PKB-number: PKB12 Definition: tRNA-like structure 3'end pseudoknot of wild cuc ...
RP0093 93 CCCCCTCCTGTGGGCTACAGGA (((::[[[[[[)))::]]]]]] AF035402 andean potato latent virus PKB-number: PKB14
Definition: tRNA-like structure 3'end pseudoknot of andean ...
RP0092 92 CGTCTATCCTGAACGTCATCAGGA (((:::[[[[[[))):::]]]]]] U91413 calopogonium yellow vein virus PKB-number: PKB13 Definition: tRNA-like structure 3'end pseudoknot of calopogo ...
RP0094 94 CCCCCTCCCGTGGGTCAACGGGA (((::[[[[[[))):::]]]]] J04374 eggplant mosaic virus PKB-number: PKB15
Definition: tRNA-like structure 3'end pseudoknot of eggplan ...
RP0095 95 CGCCCATCTCGAGCGTCATCGAGA (((:::[[[[[[))):::]]]]]] AF035202 okra mosaic virus PKB-number: PKB16
Definition: tRNA-like structure 3'end pseudoknot of okra mo ...
RP0096 96 CCCAAAACCCTGGGGATACAGGG (((::::[[[[[))):::]]]]] J02413 tobacco mosaic virus PKB-number: PKB17
Definition: tRNA-like structure 3'end pseudoknot of cowpea ...
RP0097 97 CCGTTACCCCCGGTAGGGG (((:::[[[[)))::]]]] J02415 tobacco mosaic virus PKB-number: PKB18
Definition: tRNA-like structure 3'end pseudoknot of tobacco ...
RP0098 98 CCCGAACCGCGGGTAGCGG (((:::[[[[)))::]]]] X72587 pepper mild mottle virus PKB-number: PKB19
Definition: tRNA-like structure 3'end pseudoknot of pepper ...
RP0099 99 CCTTTTCCCCGGGTAGGGG (((:::[[[[)))::]]]] D12505 cucumber green mottle mosaic virus PKB-number: PKB20
Definition: tRNA-like structure 3'end pseudoknot of cucumbe ...
RP0172 172 GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] AF033811 Moloney murine leukemia virus PKB-number: PKB47 Definition: Gag/pol translational readthrough site of Molone ...
RP0173 173 GGGTTCTCCCGCCCTCCGTGAACCCAGGCTAAAAGTTAAGGTAGGGGGGC ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]] M54993 spleen necrosis virus PKB-number: PKB48 Definition: Gag/pol translational readthrough site of spleen ...
RP0174 174 CGAGGGGCGGTTGGCCTCGTAAAAAGCCGC (((((:[[[[[[::))))):::::]]]]]] U68074 E.coli PKB-number: PKB49 Definition: Pseudoknot PK1 of E.coli tmRNA Organism: E.coli ...
RP0177 177 GTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAAGACTGAC ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]] U68074 E.coli PKB-number: PKB52 Definition: Pseudoknot PK4 of E.coli tmRNA Organism: E.coli ...
RP0175 175 CCTCTCTCCCTAGCCTCCGCTCTTAGGACGGGGATCAAGAGAGGTCAAACCCAAAAGAG (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]] U68074 E.coli PKB-number: PKB50 Definition: Pseudoknot PK2 of E.coli tmRNA Organism: E.coli ...
RP0176 176 GCGTGGAAGCCCTGCCTGGGGTTGAAGCGTTAAAACTTAATCAGGC ((((:::(((((:[[[[[))))):::)))):::::::::::]]]]] U68074 E.coli PKB-number: PKB51 Definition: Pseudoknot PK3 of E.coli tmRNA Organism: E.coli ...
RP0178 178 GGATTGTGTCCGTAATCACA (((:[[[[))):::::]]]] J02415 tobacco mosaic virus PKB-number: PKB53 Definition: Pseudoknot PK1 of the upstream pseudoknot domain ...
RP0179 179 CGTGGTGCGTACGATAACGCAT (((:[[[[[[))):::]]]]]] J02415 tobacco mosaic virus PKB-number: PKB54 Definition: Pseudoknot PK2 of the upstream pseudoknot domain ...
RP0180 180 AGTGTTTTTCCCTCCACTTAAATCGAAGGG ((((:::::[[[[[))))::::::]:]]]] J02415 tobacco mosaic virus PKB-number: PKB55 Definition: Pseudoknot PK3 of the upstream pseudoknot domain ...
RP0171 171 GGCGGCGGCGTCCGCCGTAACAAACGC (((((::[[[[))))):::::::]]]] L25299 barley yellow dwarf virus PKB-number: PKB46 Definition: ORF2/ORF3 (putative RNA-dependent RNA polymerase ...

Main Database

Page 7 of 23
ID# ID Sequence Structure Organism Notes
RP0181 181 TAACGTTGATAGTGTTGAACTATC ((((((:[[[[)))))):::]]]] U34586 odontoglossum ringspot virus PKB-number: PKB56 Definition: Pseudoknot PK1 of the upstream pseudoknot domain ...
RP0182 182 TGTGTCTTGGATCGCGCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGA (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]] J02415 tobacco mosaic virus PKB-number: PKB57 Definition: tRNA-like structure bulge pseudoknot of tobacco ...
RP0183 183 AGTGTTTGTCCCTCCACTTAAATCGAAGGG ((((:::::[[[[[))))::::::]:]]]] U34586 odontoglossum ringspot virus PKB-number: PKB58 Definition: Pseudoknot PK3 of the upstream pseudoknot domain ...
RP0184 184 CGTGGTGCATACGATAATGCAT (((:[[[[[[))):::]]]]]] U34586 odontoglossum ringspot virus PKB-number: PKB59 Definition: Pseudoknot PK2 of the upstream pseudoknot domain ...
RP0185 185 AGTGTTTATCCCTCCACTTGAATCGAAGGG ((((:::::[[[[[))))::::::]:]]]] U34586 odontoglossum ringspot virus PKB-number: PKB60 Definition: Pseudoknot PK3 of the upstream pseudoknot domain ...
RP0186 186 CGTTGTGTACACGATAGTACAT (((:[[[[[[))):::]]]]]] U34586 odontoglossum ringspot virus PKB-number: PKB61 Definition: Pseudoknot PK2 of the upstream pseudoknot domain ...
RP0187 187 GGATGCAAATCCCATTTG (((::[[[[)))::]]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen ...
RP0188 188 AACTTTAGGTTTCCTA (((::[[[)))::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen ...
RP0189 189 AAAGGGGTTTTTAACC (((::[[[)))::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen ...
RP0190 190 CGTTGTGTACACGATAGTAC (((:::[[[[))):::]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme ...
RP0191 191 CGTGGTGCATACGATAATGC (((:::[[[[))):::]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0192 192 CGTTGTGTACACGATAGTACA (((::[[[[[:::)))]]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0193 193 CGTGGTGCATACGATAATGCA (((::[[[[[:::)))]]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0194 194 AAAGGACGATCTTTCGCGATCG (((:::[[[[[:::)))]]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0195 195 GGTGCAGTATAACCCGTTATAC (((:::[[[[[:::)))]]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0196 196 CCCTTACCTCGGGTAGAGG (((:::[[[[::)))]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0197 197 TAAAAAGAAATTTTAACTCTCCAGATTT ((((:::[[[[)))):::::::::]]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0198 198 AAATCTCTGAATTTATTAATTTATCAG ((((::[[[[)))):::::::::]]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem ...
RP0199 199 GCATACGATAATGCATAGTGGCTATC ((((::[[[[))))::::::::]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1 Odontoglossum ringspot virus RNA for replicase, movemen ...
RP0200 200 GTACACGATAGTACATAGTGTTTATC ((((::[[[[))))::::::::]]]] X82130.1 Odontoglossum ringspot viru >gi|558231|emb|X82130.1 Odontoglossum ringspot virus RNA for replicase, movemen ...
RP0203 203 AGTGGTTATCCCTCCACTTAAATCGAAGGG ((((:::::[[[[[))))::::::]:]]]] U34586 odontoglossum ringspot virus PKB-number: PKB62 Definition: Pseudoknot PK3 of the upstream pseudoknot domain ...
RP0201 201 AAAGGACGATCTTTCGCGATCG ((((::[[[[))))::::]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1 Odontoglossum ringspot virus RNA for replicase,
moveme ...
RP0202 202 CGTTGTGTACACGATAGTACAT (((:[[[[[[))):::]]]]]] U34586 odontoglossum ringspot virus PKB-number: PKB61
Definition: Pseudoknot PK2 of the upstream pseudoknot domai ...
RP0204 204 CGTGGTGCATACGATAATGCAT (((:[[[[[[))):::]]]]]] U34586 odontoglossum ringspot virus PKB-number: PKB63
Definition: Pseudoknot PK2 of the upstream pseudoknot domai ...
RP0205 205 CGAGAAGGAGATCTCTCGTAAATAAGACTC (((((::[[[:[[))))):::::::]]]]] U68079 Legionella pneumophila PKB-number: PKB67
Definition: Pseudoknot PK1 of Legionella pneumophila tmRNA
...
RP0206 206 TGACCAGCTATGAGGTCATACATCGTCATAGC (((((:[[[[[[[))))):::::::]]]]]]] X12460 T2 bacteriophage PKB-number: PKB73
Definition: Pseudoknot of the regulatory region of bacterio ...
RP0208 207 TGCCAGCTATGAGGTAAAGTGTCATAGC ((((:[[[[[[[)))):::::]]]]]]] J02513 bacteriophage T4 PKB-number: PKB74
Definition: Pseudoknot of the regulatory region of T4 bacte ...
RP0208 208 GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCACTGTCGGGGGGC ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] J01998 AKV murine leukemia virus PKB-number: PKB78
Definition: Gag/pol translational readthrough site of AKV m ...
RP0215 215 AGTTTGGTCGTACTTAACGACC (((::[[[[[[)))::]]]]]] J02413 tobacco mosaic virus PKB-number: PKB85
Definition: Pseudoknot PK1 of the upstream pseudoknot domai ...
RP0214 214 AGTGTTTTTCCCTCCACTTAAATCGAAGGG ((((:::::[[[[[))))::::::]:]]]] X02144 tobacco mosaic virus PKB-number: PKB84
Definition: Pseudoknot PK3 of the upstream pseudoknot domai ...

Main Database

Page 8 of 23
ID# ID Sequence Structure Organism Notes
RP0213 213 CGTGGTACGTACGATAACGTAC (((:[[[[[[))):::]]]]]] X02144 tobacco mosaic virus PKB-number: PKB83
Definition: Pseudoknot PK2 of the upstream pseudoknot domai ...
RP0212 212 AAAGTTTGTGTTTCTAAAACACA (((:::[[[[)))::::::]]]] X02144 tobacco mosaic virus PKB-number: PKB82
Definition: Pseudoknot PK1 of the upstream pseudoknot domai ...
RP0211 211 GCGATTTCTGACCGCTTTTTTGTCAG (((::::[[[[[)))::::::]]]]] * PKB-number: PKB81
Definition: Oligonucleotide PK5
Organism:
Abbreviation: ...
RP0210 210 GGGGCAGTCCCCTAGCCCCGCTCAAAAGGGGGAT (((((:[[[[[[[:)))))::::::::]]]]]]] AF033807 mouse mammary tumor viru PKB-number: PKB80
Definition: Gag/pro ribosomal frameshift site of mouse mamm ...
RP0209 209 GGGTTCGGACCCCCTCCCCGAACCTAGGGTAACACTGACTGUGGAGGGG ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]] M26927 gibbon ape leukemia virus PKB-number: PKB79
Definition: Gag/pol translational readthrough site of gibbo ...
RP0216 216 TGCAGGCTTGTGCACATTGGGCCCCCAAG ((((::[[[[)))):::::::::::]]]] D00647.1|BLVGPE Bovine leukemia virus method: computational linguistic plus MSA BLAST James F. Lynn 08-04-2009
RP0217 217 TTAGCCACTTTTTAAAAGAAAAG (((::::[[[[[))):::]]]]] >A07108 HIV >A07108 hiv James F.Lynn 08-09-2009
RP0218 218 AGTACACATCCCACTAGGGGATG (((:::[[[[[[)))::]]]]]] >A07108 HIV >A07108 HIV James F.Lynn 08-09-2009
RP0219 219 TGTGCACCAACACATAGACTTGTTGG (((:::[[[[[))):::::::]]]]] X52374 Berne virus >gi|58776|emb|X52374.1| Berne virus mRNA for polymerase TGTGCACCAACACATAGACTTGT ...
RP0220 220 TTTTAGGAAAATAAAAAACATATTTT ((((:::[[[[[)))):::::]]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0221 221 TTTTAAATTTTAAAAGCATCAAAA ((((:::[[[[)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0222 222 ATATTTTTATTATTATTAATAA (((:::[[[[))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0224 224 ATATTAAAAATATTCACCTTTT (((:::[[[[))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0223 223 TATAAGTAATATAATAATATTA (((:::[[[[))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0227 227 CTCTGAAATTGAGGCAATAATT (((:::[[[[))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0228 228 AAATAAAAAGTTATTATTTATATTACTT ((((:::[[[[::::)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0225 225 TATTTCATATATATGTAAATAT (((:::[[[[))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0226 226 AAAGATACTCTTTGAGAGGAGT (((:::[[[[))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0229 229 TTTTAGGAAAATAAAAAACATATTTT ((((:::[[[[::)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0230 230 TTTGCTTTAATAAAAATTCCTTAA (((:::[[[[::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0231 231 TTAACTTTGGAGTAAAAAGTCCAA (((:::[[[[::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0232 232 ATTGTAAATAAAAATAAATGTATT (((:::[[[[::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0233 233 TCTCAAATAATAAGAGCTATTTAT (((:::[[[[::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0234 234 GGAAACACAACATTCCAAAGCTTGT (((:::[[[[:::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0235 235 ATATTTTTATTATTATTAATAATAA (((:::[[[[:::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0236 236 TTTAGGAAAATAAAAAACATATTTT (((:::[[[[:::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0237 237 CTCTTGAACCCAGGAGGCAGAGGTT (((:::[[[[:::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0238 238 GGGAGTTTGTTTTCCCTTTTGAACA ((((:::[[[[:)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0240 239 ATATATGTAAATATATTCTCTTTTA ((((:::[[[[:)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0240 240 ATATATATATATATATATACATATA ((((:::[[[[:)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...

Main Database

Page 9 of 23
ID# ID Sequence Structure Organism Notes
RP0241 241 TTTTGCTTTAATAAAAATTCCTTAA ((((:::[[[[:)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0242 242 TGGAGTGTGCTCTCCAGGATCAGCA ((((:::[[[[:)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0243 243 CTTAAGCTGATAAGCAACTTCAG (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0244 244 CTTAAGCTGATAAGCAACTTCAG (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0245 245 CCCCAGAAAATGGGTTTTCTTTT (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0246 246 ATTAAAATTTCAATGAATAAAAT (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0248 248 AATAATTTAAAATTGAAATTTAA (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0247 247 TTTAAATTTTAAAAGCATCAAAA (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0249 249 GGCATGAAATTGCCTTAAAATTT (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0250 250 AACATCTTTTTGTTGCAGAAAAA (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0251 251 ATTTGATGAAGAATGAATATTCA (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0252 252 TTAAATTTTAGACCTAAAACCATAAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0253 253 TTAAATTTTAGACCTAAAACCATAAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0254 254 TGAAACTTTTCCAATCAATAGAAAAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0255 255 CTGGAGTGGAACTCCAGCAAACTCCA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0256 256 CTTTTAATAAATTTAAGACGCTTTAT (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0257 257 TATTGTAAATAAAAATAAATGTATTT (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0258 258 TAAATATTTTCTCCTTAAAACTAAAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0259 259 GCTTTGTTATATTCAGCAAAATATAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0260 260 TTTTGCTTTAATAAAAATTCCTTAAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0261 261 TTAAATTATATTAATAAATTTTTATA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0263 263 AATTTAAAATTGAAATTTAAATATTT (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0262 262 GGCAGATTTAATCAGCCAGAATTAAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye ...
RP0264 264 AATATGTCTTACACTATTACA (((([[[:::::::))))]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme ...
RP0265 265 AAATCTCTGAATTTATTAATTTATCAG ((((::[[[:))))::::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme ...
RP0266 266 ACTGTTCAACAGCAGTTTGCTGATGTTTG ((((::[[[:::))))::::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme ...
RP0270 270 GAAAACTTTTTTTTTCCGCTAGTAAAA (((((::[[[:)))))::::::::]]] DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J ...
RP0267 267 TGCATACGATAATGCATAGTGGCTATC (((((::[[[:)))))::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme ...
RP0268 268 TGTACACGATAGTACATAGTGTTTATC (((((::[[[:)))))::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme ...
RP0269 269 AGCAGGATATGCTAACAGATAT (((:::[[[[))):::::]]]] DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J ...

Main Database

Page 10 of 23
ID# ID Sequence Structure Organism Notes
RP0271 271 AGCATCCCCCAGCTGCTTCAGGTGCAGGG ((((:::[[[:::)))):::::::::]]] DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J ...
RP0272 272 AATTTACTTTTTCAATTGATGAAAATTGTGAAA ((((:::::[[[[))))::::::::::::]]]] DQ249299 Duck hepatitis virus >gi|82468324|gb|DQ249299.1| Duck hepatitis virus 1 strain 03D, complete sequenc ...
RP0273 273 CAGGTACCATAAACCTGTTTTTCCTGGGTTTTA ((((:::::[[[[))))::::::::::::]]]] DQ249299 Duck hepatitis virus >gi|82468324|gb|DQ249299.1| Duck hepatitis virus 1 strain 03D, complete sequenc ...
RP0274 274 GGTGTTAATTTAGGTGAACATCAAGCCT (:((((:::::[[[::)))):):::]]] X52374 Berne virus >gi|58776|emb|X52374.1| Berne virus mRNA for polymerase Computational James F. ...
RP0275 275 TTTCAGACCCCCTTGACTGACAACCAAG (:((((:::::[[[::)))):):::]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational ...
RP0276 276 GGTTTATTGCTCAATATAAAACAATTTG (:((((:::::[[[::)))):):::]]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa ...
RP0277 277 AATCTCAATATGGATTAGCCACTCAATT ((((::[[[:::)))):::::::::]]] CY043336.1| Influenza A virus >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme ...
RP0278 278 ATCTGGAATATCAGATAGGATACATAT (((((::[[[:)))))::::::::]]] CY043336.1| Influenza A virus >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme ...
RP0279 279 TTTGTGGTGTAAACAGTGACAC (((:::[[[[))):::::]]]] CY043336.1| Influenza A virus >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme ...
RP0280 280 AATGAAAATTCATTGATTAACTATT ((((::[[[:))))::::::::]]] DQ113899.1| Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat ...
RP0281 281 AAGCAGCTTCATCAGCTTTTAAAAAAGTGAA ((((:::[[[[:::)))):::::::::]]]] DQ113899.1| Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat ...
RP0282 282 AATTATCAACGCGGAAATTGAT (((([[[::::::::))))]]] DQ113899.1| Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat ...
RP0283 283 ATAAGAACAATTTTATCAAAAACTTTGT ((((::[[[:::)))):::::::::]]] DQ113898.1| Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computati ...
RP0284 284 AAGCTCCTGATGCTTTTGATTGGTCACAG ((((::[[[::)))):::::::::::]]] DQ113898.1| Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computati ...
RP0285 285 AAGCGTTCTTTGCTTATGAAAAAG ((((:::[[[[)))):::::]]]] DQ113897.1| Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio ...
RP0286 286 TCTATATCAGTAGAAGATAAAATTGA ((((::[[[:)))):::::::::]]] DQ113897.1| Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio ...
RP0287 287 TAATTAGAACTAATTATGTGAATGGTT (((((::[[[:)))))::::::::]]] DQ113897.1| Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio ...
RP0288 288 GAAGAAATATTTCATCTGATAT (((:::[[[[))):::::]]]] DQ113897.1| Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio ...
RP0319 319 TGGTTAACTGCGAGACCAACAAGTCGAGCAG ((((:::[[[[:::)))):::::::::]]]] CP000473 computational-sequence comparison James F. lynn 08-19-2009 CP000473/~1252545-12 ...
RP0289 289 CTTATTCCTATAAGTCAATAGAAAAGG ((((::[[[:))))::::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0320 320 AGCTTGACTGCAAGAGCTACAACTCAAGCAG ((((:::[[[[:::)))):::::::::]]]] AY584522 computational-sequence comparison James F. lynn 08-19-2009 AY584522/~1870-1977
RP0293 293 TTTATGAGAAAAAGCTCTTTCT (((:::[[[[))):::::]]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0294 294 CCGACCGCGAGAGTTTCGGCGG (((([[[::::::::))))]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0291 291 TTAATATAACTAATTTTGGTTA (((:::[[[[))):::::]]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0295 295 GGATTTCTTCAATAATCCCCCCATT (((((:::::[[[)))))::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0297 297 GCCCGTTCAAGGGGGCTCAGCCT ((((:::::[[[))))::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0296 296 TTTCTCGTCGGAAGAAAATATGCTGAGCTTTCC ((((:::::[[[[))))::::::::::::]]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0298 298 TCGGAACTGGCCCGAACAATGCCA ((((:::[[[[)))):::::]]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0290 290 GAAGGCCAAGCTTCAAGAGTGAATTTG ((((::[[[:))))::::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0299 299 CTTATTCCTATAAGTCAATAGAAAAGG ((((::[[[:))))::::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...

Main Database

Page 11 of 23
ID# ID Sequence Structure Organism Notes
RP0300 300 GAAGGCCAAGCTTCAAGAGTGAATTTG ((((::[[[:))))::::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0301 301 GAAGAAGTATTTCATCTGATAT (((::::[[[)))::::::]]] AC183531 Pan troglodytes >gb|AC183531.2 Pan troglodytes BAC clone CH251-637O1 from chromosome 2, complet ...
RP0292 292 AAAAGAGAAGTTTGACGCCTTC (((:::[[[[))):::::]]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0302 302 GAAGAAGTATTTCATCTGATAT (((::::[[[)))::::::]]] AC148022 Homo sapiens >gb|AC148022.2| Homo sapiens BAC clone RP11-1383G16 from 2, complete sequence ...
RP0303 303 ATGGGGACAGCCCCATGGTGGTGGCTG (((((::[[[:)))))::::::::]]] M33958 >M33958 computational-sequence comparison James F. lynn 08-19-2009
RP0304 304 AGGTTCCCTCAACCTGGACGGCAATCAGG ((((::[[[::)))):::::::::::]]] CP000511 >CP000511 ~3501682 computational-sequence comparison James F. lynn 08-19-2009
RP0305 305 AGGTTCCCTCAACCTGGACGGCAATCAGG ((((::[[[::)))):::::::::::]]] BX842576 >BX842576/93135-93242 computational-sequence comparison James F. lynn 08-19-2009
RP0307 306 AGGTTCCCTCAACCTGGTTGGTAATCAGG ((((::[[[::)))):::::::::::]]] AM711867 >AM711867 computational-sequence comparison James F. lynn 08-19-2009 -2868776
RP0307 307 CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] U08309 geoffroyi prion >gi|474376|gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cd ...
RP0308 308 AGGTTCCCTCAACCTGGTTGGTAATCAGG ((((::[[[::)))):::::::::::]]] AM711867 computational-sequence comparison James F. lynn 08-19-2009 ((((::[[[::)))):::::: ...
RP0309 309 CGGTCGGCAACCGTCCTTTTGAATGC ((((::[[[))))::::::::::]]] AAVN02000007 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009 ( ...
RP0310 310 TGTAAGACCTACAAGTCGAGCAGGGT ((((::[[[))))::::::::::]]] AY584518 computational-sequence comparison James F. lynn 08-19-2009
RP0311 311 TGGTTAACTGCGAGACCAACAAGTCGAGCAG ((((:::[[[[:::)))):::::::::]]]] CP000473 computational-sequence comparison James F. lynn 08-19-2009 CP000473/~1252545-12 ...
RP0312 312 AGCTTGACTGCAAGAGCTACAACTCAAGCAG ((((:::[[[[:::)))):::::::::]]]] AY584522 computational-sequence comparison James F. lynn 08-19-2009 ((((:::[[[[:::)))): ...
RP0313 313 CATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] NM_000311.3| Homo sapiens prion computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho ...
RP0314 314 CATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] NM_000311.3| Homo sapiens prion protein computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho ...
RP0315 315 CATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] NM_000311 Homo sapiens prion protein computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho ...
RP0316 316 CATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] NM_000311.3| Homo sapiens prion protein computational-sequence comparison James F. lynn 08-26-2009 >ref|NM_000311.3| Ho ...
RP0317 317 CGGTCGGCAACCGTCCTTTTGAATGC ((((::[[[))))::::::::::]]] AAVN02000007 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009
RP0318 318 TGTAAGACCTACAAGTCGAGCAGGGT ((((::[[[))))::::::::::]]] AY584518 computational-sequence comparison James F. lynn 08-19-2009 AY584518 -1983
RP0323 322 CCTCGACCTTGAGGGAATGCTAAAGG ((((::[[[:)))):::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0326 326 ATTATATAATTTTAATTTTAATTGGCTTA ((((::[[[:::))))::::::::::]]] AF311938 computational-sequence comparison James F. lynn 08-26-2009 >AF311938 ~7320-7445
RP0324 324 TTGAGAGAATGTCAAGAATCTTTTGTTTC ((((::[[[::)))):::::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0325 325 CCCGCCCACCTCGGGCCTCGTCTTGTG ((((::[[[::)))):::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0323 323 CCTGAAAGAACAGGGGAAGGTCTCT ((((::[[[:))))::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0328 328 CTCTTTTTAAATTAGAGACAATTTGAACTAATT ((((:::::[[[[))))::::::::::::]]]] AF085363 computational-sequence comparison James F. lynn 08-19-2009 AF085363 ~7286-7411
RP0329 329 AATTAACAAATTATAATTGGCTTAA (((((:::::[[[)))))::::]]] AJ577589 Human echovirus 11 computational-sequence comparison James F. lynn 08-19-2009 >AJ577589 ~7312-7433
RP0327 327 CTCTTTTTAAATTAGAGACAATTTGAACTAATT ((((:::::[[[[))))::::::::::::]]]] M16560 computational-sequence comparison James F. lynn 08-19-2009 >M16560/7270-7389
RP0330 330 CTCCTTCTAAATTGGAGACAATTTGAAATAATT ((((:::::[[[[))))::::::::::::]]]] AY302556 Human echovirus 33 computational-sequence comparison James F. lynn 08-19-2009 >AY302556 ~7274-7394
RP0321 321 CTCTTTTTAAATTAGAGACAATTTGAAATAATT ((((:::::[[[[))))::::::::::::]]]] AF241359 computational-sequence comparison James F. lynn 08-19-2009 >AF241359 ~7291-7411

Main Database

Page 12 of 23
ID# ID Sequence Structure Organism Notes
RP0331 331 TATTGCAAGGGCAATAAGAACTGAGGCTT ((((::[[[:::))))::::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0332 332 CCTCGACCTTGAGGGAATGCTAAAGG (((((:[[[))))):::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0333 333 GGATTCTATTACATCCAGA (((([[[:::::))))]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P ...
RP0334 334 GTATCAAGGCCTCATACTGTATGGCC ((((:::[[[[::)))):::::]]]] NC_001782 Saccharomyces cerevisiae killer virus method: computational James F. Lynn 10-23-2009 >gi|9629210|ref|NC_001782.1| Sacc ...
RP0336 336 CCAAGGCTTCTGGCCCAAGAAG (((:::[[[[))):::::]]]] NC_013116 Sclerotinia sclerotiorum hypovirulence a method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc ...
RP0335 335 TATGCATTGACATATAGCAGGTACAA ((((::[[[:)))):::::::::]]] NC_001782 Saccharomyces cerevisiae killer virus method: computational James F. Lynn 10-23-2009 >gi|9629210|ref|NC_001782.1| Sacc ...
RP0337 337 GGGGAGGGGCCCCCTGGGGGGGACCC ((((::[[[))))::::::::::]]] NC_013116 Sclerotinia sclerotiorum hypovirulence a method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc ...
RP0338 338 AAGTTTGATAAGACTTGGACTATGCAATC ((((::[[[:::))))::::::::::]]] NC_013116 Sclerotinia sclerotiorum hypovirulence a method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc ...
RP0339 339 GTATATCGTCGAATACAGCGTATTCCACG ((((::[[[:::))))::::::::::]]] NC_013116 Sclerotinia sclerotiorum hypovirulence a method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc ...
RP0340 340 TTGTGGCGATACAAGCAGGGCTATCG ((((::[[[:)))):::::::::]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...
RP0341 341 GTGGGTCCTCCACCATCTCAGAAAGG ((((::[[[))))::::::::::]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr ...
RP0342 342 TTGCACTCCCTGCAAGGGACACAGAGGG ((((:::[[[[)))):::::::::]]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr ...
RP0343 343 GGGGCACTGTCCCCGCCAGGTGCAG ((((::[[[:))))::::::::]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr ...
RP0344 344 TCGAAGAGGGCGAAATCGCCCT (((:::[[[[))):::::]]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr ...
RP0345 345 CCACCCGTAAGTGGTATCTTAC ((((::[[[[))))::::]]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr ...
RP0346 346 TATCACTCCAGATACTGGTTTCCAGGA ((((::[[[:))))::::::::::]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr ...
RP0347 347 ACCACCTCAGATGGTTCTTGGAACAGTGA ((((::[[[::)))):::::::::::]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr ...
RP0348 348 GCGGCCTCGTAGTGGCCGCAGG (((([[[::::::::))))]]] NC_003871 Carrot red leaf luteovirus method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car ...
RP0349 349 TCGCTAAAGAGGCAGCGATGGAAGCAGCTCT ((((:::[[[[:::)))):::::::::]]]] NC_003871 Carrot red leaf luteovirus method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car ...
RP0350 350 TAGTATTTTATACTAACTCTAGGAATAA ((((:::[[[[)))):::::::::]]]] NC_003871 Carrot red leaf luteovirus method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car ...
RP0351 351 AATCACAAGGGTGATTTGT (((([[[:::::))))]]] NC_003871 Carrot red leaf luteovirus method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car ...
RP0352 352 GGAGGCGGGCCTCCCGATCCGAGGGGCCC ((((::[[[[)))):::::::::::]]]] NC_001653 Hepatitis delta virus method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep ...
RP0353 353 ACCGTCCCCTCGGTAATGGCGAATGGG ((((::[[[:))))::::::::::]]] NC_001653 Hepatitis delta virus method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep ...
RP0356 356 GGCCCCATCGGCCCTGTGGGTAGGAT ((((::[[[))))::::::::::]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...
RP0354 354 GGGGGTTCACACCCCCAAC (((([[[:::::))))]]] NC_001653 Hepatitis delta virus method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep ...
RP0357 357 AAAGGGTGGAACTGCTTTGGATCATCTTTCC ((((:::[[[[:::)))):::::::::]]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...
RP0358 358 ACAGCACGTAGAAACTGTACCAGGAGCCTAC ((((:::[[[[:::)))):::::::::]]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...
RP0355 355 TTACTCTTTTCTGTAAAGA (((([[[:::::))))]]] NC_001653 Hepatitis delta virus method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep ...
RP0359 359 ATGGACATTGTTCCATGATGATTAAAAT ((((::[[[:::)))):::::::::]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...
RP0361 361 CTGGAGGAACAATCCAGCGGATATTTGTT (((((::[[[[[))))):::::::]]]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...

Main Database

Page 13 of 23
ID# ID Sequence Structure Organism Notes
RP0362 362 GATATTGGAGTGAATATCTTGATCA (((((:::::[[[)))))::::]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...
RP0363 363 CCTGGGCGGGTGCAGGAGGCCAAAGGCCG ((((::[[[:::))))::::::::::]]] NC_012126 California sea lion anellovirus method: computational James F. Lynn 10-25-09 >gi|224504298|ref|NC_012126.1| Cali ...
RP0360 360 CCTCCTCGTTATCGAGGAGGCTTCAGAAC ((((:::[[[:::)))):::::::::]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha ...
RP0380 380 GCAGATGACCCTGCAAGACATGGGTC ((((::[[[:)))):::::::::]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke ...
RP0364 364 TTTTCAACAACAAAATCCTGGTTG ((((:::[[[[)))):::::]]]] NC_012126 California sea lion anellovirus method: computational James F. Lynn 10-25-09 >gi|224504298|ref|NC_012126.1| Cali ...
RP0365 365 AAAATATTTCTTTTACAGATGCAAAA ((((::[[[:)))):::::::::]]] NC_007013 Small anellovirus 1 method: computational James F. Lynn 10-25-09 >gi|66391749|ref|NC_007013.1| Small ...
RP0366 366 AGGTTACTTTTCACCTAGAATACTACAAG ((((::[[[:::))))::::::::::]]] NC_007013 Small anellovirus 1 method: computational James F. Lynn 10-25-09 >gi|66391749|ref|NC_007013.1| Small ...
RP0367 367 GCAAAAAACATTGCTGCCACAATGTT (((:::[[[[[[[:)))::]]]]]]] NC_007013 Small anellovirus 1 method: computational James F. Lynn 10-25-09 >gi|66391749|ref|NC_007013.1| Small ...
RP0368 368 GTTTTGGAAAAGAAGAAACCCA (((([[[::::::::))))]]] NC_007014 Small anellovirus 2 method: computational James F. Lynn 10-25-09 >gi|66391753|ref|NC_007014.1| Small ...
RP0369 369 ACCTGGAGGAGGAGGTTTTGCCT ((((:::::[[[))))::::]]] NC_007014 Small anellovirus 2 method: computational James F. Lynn 10-25-09 >gi|66391753|ref|NC_007014.1| Small ...
RP0370 370 CGAAATCGAATTCGTCCGTTCTCTCG ((((::[[[:)))):::::::::]]] NC_001944 Beak and feather disease virus method: computational James F. Lynn 10-25-09 >gi|9630729|ref|NC_001944.1| Beak a ...
RP0371 371 CGGGGGGGGGGCCCCGGGGGGTCCCCC (((((::[[[:)))))::::::::]]] NC_001944 Beak and feather disease virus method: computational James F. Lynn 10-25-09 >gi|9630729|ref|NC_001944.1| Beak a ...
RP0372 372 ACTTTTAATAAAGTGAAGTGGTATT ((((::[[[:))))::::::::]]] NC_002068 Bovine circovirus method: computational James F. Lynn 10-25-09 >gi|9631282|ref|NC_002068.1| Bovine ...
RP0373 373 GTATTCTGATTACCAGCAATCA (((:::[[[[))):::::]]]] NC_002068 Bovine circovirus method: computational James F. Lynn 10-25-09 >gi|9631282|ref|NC_002068.1| Bovine ...
RP0374 374 GCAACCGGAGTGACCTTGCCGG (((([[[::::::::))))]]] NC_003410 Canary circovirus method: computational James F. Lynn 10-25-09 >gi|18875309|ref|NC_003410.1| Canar ...
RP0375 375 CCCCCGTCGAGGGGCCGAAGGCCCCGA ((((::[[[:))))::::::::::]]] NC_003410 Canary circovirus method: computational James F. Lynn 10-25-09 >gi|18875309|ref|NC_003410.1| Canar ...
RP0376 376 CAAATAAATGTTTGGTGTCTTTATT ((((::[[[:))))::::::::]]] NC_003410 Canary circovirus method: computational James F. Lynn 10-25-09 >gi|18875309|ref|NC_003410.1| Canar ...
RP0377 377 GGGGGCCGGAGGCCCCCCGGTGGCC (((((:::::[[[)))))::::]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke ...
RP0378 378 TACGTCACGCGTACAGGGGGGTACGT ((((::[[[))))::::::::::]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke ...
RP0379 379 ACCATCGGCATGGTGGAGATGGGCC ((((::[[[:))))::::::::]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke ...
RP0381 381 GGGGGGGGGCTAAAGCCCCCCC (((([[[::::::::))))]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke ...
RP0382 382 CCCCCCCCTGGGGGGGATTCCCC ((((:::::[[[))))::::]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke ...
RP0385 385 CTTGCCCCCCCAAGCGTTAATGAAGGG ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0386 386 TTTATTGTTAAAAATAAACAA (((([[[:::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0387 387 TTTAATTGCCGTAATAAAAAT (((([[[:::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0388 388 CATCGGTATAATGATCAGTATA (((:::[[[[))):::::]]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0389 389 ATCACCTAATGAGTGATGAGCCCATT ((((:::[[[[::)))):::::]]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0390 390 ATTGATGGCCAGCAATTCCTCTG ((((:::::[[[))))::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0391 391 CAGTAAACTACACTGAAAATACATCAAGT ((((::[[[::)))):::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0392 392 CTGTCCTGCCACAGGAGTCCACAAGCA ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...

Main Database

Page 14 of 23
ID# ID Sequence Structure Organism Notes
RP0393 393 AAGGTACTGGGACCCTTACTGTCCCTCCA ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0394 394 AGGATGTTTGTCCTACTCTCAGAAAA ((((::[[[:)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0395 395 TAAGTCACAGCTTAGTCAATTATGT ((((::[[[:))))::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0396 396 CTTGCCCCCCCAAGCGTTAATGAAGGG ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0397 397 CAAACTCCCATTTGGGCCTTGAGGG ((((::[[[:))))::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0398 398 TGTTGAGATAGGAACACCAAGCTAT ((((:::[[[[:)))):::::]]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0399 399 CAAAAGTATACTGTTTGAACCCCTAGTAT ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0400 400 TTCAGACATTGCGTGAACTCCTCCTTAAT ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0401 401 GAAATTTTTCTTTTTCATTGAAG ((((:::::[[[))))::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0402 402 ATTGGCAATCAATAAACCTCTTGATT ((((::[[[))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0403 403 CCTGTAACTTCAGGCCTATTTCAGT ((((::[[[:))))::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0404 404 ATTACTCCGGTAATATTGTGCATCGG ((((::[[[:)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0405 405 TGAAACAAGATCCTTCACAACCCACTTCT ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0406 406 GACACTCAAGTGTCATGTCCAGGTTG ((((::[[[:)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0407 407 TATCGATTATGTTGATAATGTAAATAATA ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0408 408 AACTTCCTGGCAATCAGTTGGA (((([[[::::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0383 383 AACTTCCTGGCAATCAGTTGGA (((([[[::::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0384 384 CTGTCCTGCCACAGGAGTCCACAAGCA ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James ...
RP0409 409 TTCAATCTAGTGAAGGACCCTATAGA ((((:[[[[:))))::::::::]]]] AF038398 Simian-HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH ...
RP0410 410 TAAAAACAACTTTACTAAAATCTTGT ((((:[[[[:))))::::::::]]]] AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational 03-03-2 ...
RP0411 411 TTTTAAATTTAAAATTTTAAATAATT ((((:[[[[:))))::::::::]]]] AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational 03-03-2 ...
RP0412 412 ATAACTTGTCTTATGTGTTTACACAA ((((:[[[[:))))::::::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0413 413 AAAACTTTTTTTTTCCGCTAGTAAAA ((((:[[[[:))))::::::::]]]] DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Jam ...
RP0414 414 AGTGCCATTCACTGAATTTAAAT ((((::[[[)))):::::::]]] DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Jam ...
RP0415 415 GGTGGTTCTCGGCTGAGACCGCCGCGAGC ((:(((:::::[[[:::))):)):::]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...
RP0416 416 GGGGGGACTTAGCGCCCCCCAAACCG ((((((::::::[[))))))::::]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...
RP0419 419 CAGACCCCCTTGACTGACAACCAAG (((:::::[[[[:))):::::]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...
RP0421 421 AGTGGGTCTCTAGGGGCACACCCACTACCCGCCGGCCCCT (((((((::::[[[[[[::)))))))::::::::]]]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...
RP0422 422 TCCGGGATTGATCACCCCGGAACCCTAACGATC ((((((:::[[[[::))))))::::::::]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...
RP0417 417 TGCCCGGGCCTCGGCAACCGGCCCCCAAAAGGCCC ((((:[[[[[[:)))):::::::::::::]]]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...

Main Database

Page 15 of 23
ID# ID Sequence Structure Organism Notes
RP0418 418 AGCCCATCCCGGCGCTCTCCCCCGG (((:::::[[[[:))):::::]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...
RP0420 420 AATATATGGGTAGATTCCAAATACC (((:::::[[[[:))):::::]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 ...
RP0423 423 ACTCAGTATTGTGCCTGAGTGATGGC ((((((::::::[[))))))::::]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa ...
RP0424 424 GTACTGGCTTCTTTTGTCAGGACCCAAAA ((:(((:::::[[[:::))):)):::]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0425 425 TTCTGCTATTGCTGAACCTAAGCAA (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0426 426 ATATGCCTTCGTTTATAGCTTACGA (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0427 427 TCCTAGTATTGATGGATTCTGTCAA (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0428 428 TGAAGATTCCAGTTCAAAGTTCTGG (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0429 429 GGCAACATTTTTGGCCTTTACAAAA (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0430 430 TTCTAAGGTACATGAAGTCATTGTA (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0431 431 AAACACATTACTGTTTTATCAAGTA (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0432 432 AATCTCATCCATTTCGTGGGAT (((:::[[[[))):::::]]]] Australian bat lyssavirus AF418014 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0433 433 ATTTTATCAAAAATCTTCCCCTATTGA ((((::[[[:))))::::::::::]]] Australian bat lyssavirus AF418014 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0436 436 AATCTCATCCATTTCGTGGGAT (((:::[[[[))):::::]]]] Eupatorium yellow vein virus AB433979 >gi|195963299|dbj|AB433979.1| Eupatorium yellow vein virus- [Japan: Kagawa: Toma ...
RP0435 435 ATCAGATCAATAGATGATATC (((([[[:::::::))))]]] Australian bat lyssavirus AF418014 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0434 434 GAGTCCATAATTGGACTCATTCAAAATT ((((((::[[[[))))))::::::]]]] Australian bat lyssavirus AF418014 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0438 438 GTGGTCCCGCCCACTATCCGATGTCGG ((((::[[[:))))::::::::::]]] Chayote yellow mosaic virus NC_004618 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu ...
RP0437 437 TTGACTTGGTCAATTGGTACCA (((:::[[[[))):::::]]]] Eupatorium yellow vein virus AB433979 >gi|195963299|dbj|AB433979.1| Eupatorium yellow vein virus- [Japan: Kagawa: Toma ...
RP0439 439 CTATCTTGAAATAGAGGGGATTTGTCA ((((::[[[:))))::::::::::]]] Chayote yellow mosaic virus NC_004618 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu ...
RP0440 440 TTCAGGAAACACTTGTGAATCC (((([[[::::::::))))]]] Chayote yellow mosaic virus NC_004618 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu ...
RP0441 441 CCACACAAATAATTGTGTGGTCCCAAT ((((((:::::[[[))))))::::]]] Chayote yellow mosaic virus NC_004618 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu ...
RP0442 442 AGTCCATAATTGGACTCATTCAAAATT (((((::[[[:)))))::::::::]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0443 443 TCTCTCAGATCAGAGATCTTTTCAATC (((((::[[[:)))))::::::::]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0444 444 TTGGGTCTCCATCCAAAATCATG ((((:::::[[[))))::::]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0445 445 GTGTTATGGAACACGAGCAGTCCAT ((((:[[[[:)))):::::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome ...
RP0446 446 ACCAATGTGATGGTATTTTCACACA ((((:[[[[:)))):::::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome ...
RP0447 447 GCCATTAGAATGGCTAATGTATCTA ((((:[[[[:)))):::::::]]]] M25381 Feline immunodeficiency virus >gi|323933|gb|M25381.1|FIVCG Feline immunodeficiency virus complete genome Compu ...
RP0448 448 AACATAATGGTGTTTGGACACATT ((((:[[[[:))))::::::]]]] X52374 Berne virus mRNA >gi|58776|emb|X52374.1| Berne virus mRNA for polymerase Computational James F. L ...
RP0449 449 CAGGAGCCAGCCTGGTGATAGTGGC ((((:[[[[:)))):::::::]]]] NC_009597 Pyrococcus abyssi virus >gi|149274319|ref|NC_009597.1| Pyrococcus abyssi virus 1, complete genome Comput ...
RP0450 450 ATTTTCATTCAAATACGGCAATG ((((:[[[[:)))):::::]]]] CY043336 Influenza A virus >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme ...

Main Database

Page 16 of 23
ID# ID Sequence Structure Organism Notes
RP0451 451 TGTAACTATGTACACAGCTAATAG ((((:[[[[:))))::::::]]]] DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio ...
RP0452 452 GCAAAAAACATTGCTGCCACAATGTT (((:::[[[[[[[:)))::]]]]]]] AB290924 Torque teno midi virus >dbj|AB290924.1| Torque teno midi virus ORF1 gene for hypothetical protein, par ...
RP0453 453 GCAAAAAACATTGCTGCCACAATGTT (((:::[[[[[[[:)))::]]]]]]] AY622911 Small anellovirus >gb|AY622911.1| Small anellovirus 1 genomic sequence Length=372 James F. Lynn 0 ...
RP0454 454 GCAAAAAACATTGCTGCCACGATGTT (((:::[[[[[[[:)))::]]]]]]] AB290918 Torque teno midi virus >dbj|AB290918.1| Torque teno midi virus 1 DNA, complete genome, isolate: MD1-07 ...
RP0455 455 CCCTGCCCGGGACGGG (((::[[[)))::]]] NC_010319 Abaca bunchy top virus >gi|167006434|ref|NC_010319 Abaca bunchy top virus DNA-R, complete genome Comput ...
RP0456 456 GGCTAACTTCCTGCCGAAGGAAG (((:::[[[[[[)))::]]]]]] NC_010319 Abaca bunchy top virus >gi|167006434|ref|NC_010319.1| Abaca bunchy top virus DNA-R, complete genome Com ...
RP0457 457 GAGGATTACTTGAATTACGGAATTCTGAGGAATTCAAG ((((((:[[[[:[[[::::)))))):::::]]]:]]]] NC_010319 Abaca bunchy top virus >gi|167006434|ref|NC_010319.1| Abaca bunchy top virus DNA-R, complete genome Com ...
RP0458 458 ATATGCAAAGTATATAATACTTT (((:::[[[[[[)))::]]]]]] NC_010317 Abaca bunchy top virus >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com ...
RP0460 460 TAGAGGATCAGCCGACTCTATAAATATAGGGAGGC (((((:::::[[[::)))))::::::::::::]]] NC_010317 Abaca bunchy top virus >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com ...
RP0459 459 GGCTTCCTGCGGAAGCCAGGC (((((((:[[)))))))::]] NC_010317 Abaca bunchy top virus >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com ...
RP0461 461 GGGACATCACGTGCCTCCCTGTACACGCACGTGA ((((::[[[[[[[[:)))):::::::]]]]]]]] NC_010317 Abaca bunchy top virus >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com ...
RP0462 462 GTATTTAAATATTTAAATACCAAACCTTAAGGAAT (((((:::::[[[::)))))::::::::::::]]] NC_010315 Abaca bunchy top virus segment 2 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen ...
RP0463 463 TATATTAAATATAACATATAAAATATATAAGGTAT (((((:::::[[[::)))))::::::::::::]]] NC_010315 Abaca bunchy top virus segment 2 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen ...
RP0464 464 GCGGCTACCGCAGGTGCCGCGCGAGCGGCGTACTG (((((:::::[[[::)))))::::::::::::]]] AF009606 Hepatitis C virus Computational James F. Lynn 05/30/2010 >gi|2316097|gb|AF009606.1|AF009606 Hepati ...
RP0465 465 TTGAGGAGCTTGCTGCTCAAGAACTAATAGCAGCA (((((:::::[[[::)))))::::::::::::]]] AF218039 Cricket paralysis virus Computational James F. Lynn 05/30/2010 >gi|8895506|gb|AF218039.1|AF218039 Cricke ...
RP0466 466 ATGTTAACAAGAATGAACATTTCTGATCTTACTTC (((((:::::[[[::)))))::::::::::::]]] DQ113899 Adult diarrheal rotavirus Computational James F. Lynn 05/30/2010 >gi|69145430|gb|DQ113899.1| Adult diarrhe ...
RP0467 467 TGTTAAGAACCTGTTTAACACTTTCACAATGTCAG (((((:::::[[[::)))))::::::::::::]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C ...
RP0468 468 GAGGGATTTTCTCAGGAAAA (((:::[[[[))):::]]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome 18,87 ...
RP0469 469 ATCTCCGAAGGATTATCTTC (((:::[[[[))):::]]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS ...
RP0470 470 AATCCCCCATTTGGGG (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0471 471 CATAATTCATGCAGAA (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0472 472 CATCAGTGATGGCCAC (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0474 474 ATGTCAATCATTTATT (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0473 473 TTCAATATGAAATATA (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0475 475 TTCCACTAGAATCTAG (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0476 476 AAGAGATTCTTCAAAT (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0477 477 AAAAATATTTTAAATA (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C ...
RP0478 478 AGTCCCTCACTGAGAG (((::[[[)))::]]] AF009606 Hepatitis C virus >gi|2316097|gb|AF009606 AF009606 Hepatitis C virus Computational James F. Lynn 0 ...
RP0479 479 CTAGCAGGTAGAGCCT (((::[[[)))::]]] AF038398 Simian-Human HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S ...
RP0480 480 GGTTTTCTACCCCAGA (((::[[[)))::]]] AF038398 Simian-Human HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S ...

Main Database

Page 17 of 23
ID# ID Sequence Structure Organism Notes
RP0481 481 CATCTCCTATGGCAGG (((::[[[)))::]]] AF038398 Simian-Human HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S ...
RP0482 482 CTAGCAGGTAGAGCCT (((::[[[)))::]]] AF038398 Simian-Human HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain S ...
RP0483 483 CAACAGTTTTGACAAC (((::[[[)))::]]] AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F ...
RP0484 484 CATTTATCATGAAGAT (((::[[[)))::]]] AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F ...
RP0485 485 ATTTCGAAAATATTTC (((::[[[)))::]]] AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F ...
RP0486 486 TCACACATTGAAAATG (((::[[[)))::]]] AF218039 Cricket paralysis virus >gi|8895506|gb|AF218039.1|AF218039 Cricket paralysis virus Computational James F ...
RP0487 487 AGACAGAGTCTCTCTC (((::[[[)))::]]] AF253314 Homo sapiens >gi|10945419|gb|AF253314.1|AF253314 Homo sapiens pheromone receptor (PHB4C5) ps ...
RP0488 488 TTTAATTCAAATTGAA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0489 489 CCCGCTGCGGGCAGCA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0490 490 CAGGCCTGCTGGCCAG (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0491 491 CACTTTAAGTGGATTA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0492 492 AGATTGAGTCTTGCTC (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0493 493 TTTAATAAAAATGTTA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0495 495 TATAATCTATATTAGA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0494 494 TGAGCACTTCAATAGT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0496 496 CTATAAAATAGATTTT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0497 497 TTGACGCCCAACTGGC (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0498 498 CAGTAAAACTGTATTT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0499 499 ATACCAAATATCTTTT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0500 500 AAATTATATTTCATAT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0501 501 ATATCTATTATCTATA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0502 502 CCAGAAAATGGGTTTT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0503 503 GCTTCAATAGCCAATT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0504 504 TCAGTGATTGAAGATC (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0505 505 TTTTTTGAAAAGATCA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0506 506 AAGCATTCCTTTTGAA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0507 507 CTTTGCTAAAGCATAG (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S ...
RP0508 508 GGTTTATAACCACTAT (((::[[[)))::]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014 Australian bat lyssavirus, complete genome Computationa ...
RP0509 509 GCTACAACAGCACGTT (((::[[[)))::]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014 Australian bat lyssavirus, complete genome Computationa ...
RP0510 510 GCTGAGCCAGCAGCAGATGG ((((::[[[:)))):::]]] A04321 HIVLAIJ19 Computational KSPOS James F. Lynn 06/05/2010 present in all hiv genomes

Main Database

Page 18 of 23
ID# ID Sequence Structure Organism Notes
RP0511 511 CGCTGAAACGGAGCGATATCCGT ((((:::[[[[))))::::]]]] X78602 peanut clump virus X78602 peanut clump virus KSPOS Computational James F. Lynn 06/05/2010
RP0512 512 CCCTCTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] X16378 turnip yellow mosaic virus Computational James F. Lynn 06/05/2010 KSPOS
RP0513 513 CCCTTCCGTGGGTAACGGA (((:[[[[[)))::]]]]] Y16104 physalis mottle virus Y16104 physalis mottle virus Computational James F. Lynn 06/05/2010 KSPOS
RP0514 514 CCCTCCTGTGGGCTACAGG (((:[[[[[)))::]]]]] AF035402 andean potato latent virus AF035402 andean potato latent virus Computational James F. Lynn 06/05/2010 KSPOS
RP0515 515 AGGCCATCGCCGCCTACCGGCG ((((:::[[[[)))):::]]]] NC_000962 Mycobacterium tuberculosis >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu ...
RP0516 516 CGGCGCTGGTGGCCGCCTCACC ((((:::[[[[)))):::]]]] NC_000962 Mycobacterium tuberculosis >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu ...
RP0517 517 CGGCGACTGGGGCCGCACCCCA ((((:::[[[[)))):::]]]] NC_000962 Mycobacterium tuberculosis >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu ...
RP0518 518 GCCACCGAGCCTGGCAGGGGCT ((((:::[[[[)))):::]]]] NC_000962 Mycobacterium tuberculosis >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu ...
RP0519 519 CTGCGCGGCGAGCAGACATCGC ((((:::[[[[)))):::]]]] NC_000962 Mycobacterium tuberculosis >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu ...
RP0520 520 AGCGCTGTCCCCGCTATCGGGA ((((:::[[[[)))):::]]]] NC_000962 Mycobacterium tuberculosis >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu ...
RP0521 521 CCGGACCGCCGCCGGGTCCGGC ((((:::[[[[)))):::]]]] NC_000962 Mycobacterium tuberculosis >gi|57116681|ref|NC_000962.2|MycobacteriumtuberculosisH37Rv,completegenome Compu ...
RP0522 522 AGGCCATCGCCGCCTACCGGCG ((((:::[[[[)))):::]]]] AP010918 Mycobacterium bovis >dbj|AP010918.1| Mycobacterium bovis BCG str. Tokyo 172 DNA, complete genome Le ...
RP0523 523 AGGCCATTGCCGCCTATCGGCG ((((:::[[[[)))):::]]]] CP001798 Nitrosococcus halophilus >gb|CP001798.1| Nitrosococcus halophilus Nc4, complete genome Length=4079427 MS ...
RP0524 524 GCATTTGTAGTGCGCGCCCTAC (((:::[[[[))):::::]]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0525 525 ATAAGCCGGGTTATCAATCAGCCACCG ((((::[[[:))))::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0526 526 GGTTCAGCGCAACCCGGCCCTGCTCGC ((((::[[[:))))::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0527 527 CTTGCTCTTCAGAGCAAGGAG (((([[[:::::::))))]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0528 528 AGGCCATTGCCGCCTATCGGCG ((((:::[[[[)))):::]]]] CP000717 Mycobacterium tuberculosis >gb|CP000717.1| Mycobacterium tuberculosis F11, complete genome Length=4424435 ...
RP0529 529 CACACCCACCCGTGTGTGTTCGG ((((:::::[[[))))::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0530 530 GCGCCCCTTTGGGGGGCGCAAAGTCCAAAG (((((:[[[[[[::))))):::::]]]]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0531 531 AACCTGAATCCCAGGTTGATGAAGCGGGATGGG ((((:::::[[[[))))::::::::::::]]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0532 532 CCCGAGCCATATACGGGGTCGAGCCCATG ((((:::[[[:::)))):::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0534 534 AGGGTTCCCCCCCCTCCTCCCCCCAAGGG ((((::[[[::)))):::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0536 536 AGGGCTGCATTCCCTAAGTGGATAGGTGC ((((::[[[::)))):::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0537 537 TGCCTATGGTTGGCATACAGGCCCCACCA ((((::[[[::)))):::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0533 533 GCCTAGAAAAGTGAGGCAAGGGATGTTTT ((((:::[[[:::)))):::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0535 535 AGGGTGCCCACCCCTACTAACGCACTGGG ((((::[[[::)))):::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0538 538 ACCTGAATCCCAGGTTGATGAAGCGGGAT ((((::[[[::)))):::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0539 539 GCAGCCTGGGCTGCTCTGCGCTCCCA ((((::[[[:)))):::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0540 540 AGGCCATTGCCGCCTATCGGCG ((((:::[[[[)))):::]]]] AM408590 Mycobacterium bovis >emb|AM408590.1| Mycobacterium bovis BCG Pasteur 1173P2, complete genome Length ...

Main Database

Page 19 of 23
ID# ID Sequence Structure Organism Notes
RP0541 541 AGGCCATTGCCGCCTATCGGCG ((((:::[[[[)))):::]]]] AE000516 Mycobacterium tuberculosis >gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length=4403 ...
RP0542 542 CTTCCCCATGAAGGTGGTAGCGTATG ((((::[[[))))::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0543 543 GGGGAGGGTTCCCCCCCCT (((([[[:::::))))]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0544 544 CCTCAATCTGCTGAGGATT (((([[[:::::))))]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0545 545 GGGTTCTTGCAACCCGAGCTCCTTCCAA ((((::[[[::))))::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0546 546 CCAAGGTGGGTTGGGTAGTCCCCCCCCCA ((((::[[[[)))):::::::::::]]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0547 547 ACACCCACCCGTGTGTGTTCGGCTTGCGG (((:::::[[[)))::::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0548 548 GGGATTTTCTGCCCAGTGCCCAAAATCAG (((:::::[[[)))::::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0549 549 GTGTCCTGGTGCACTGGAGACGTGGACAC (((:::::[[[)))::::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0550 550 CCTAAGTGGATAGGTGCCAATGCTGCATC (((:::::[[[)))::::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0551 551 TTGGTTCAGCGCAACCCGGCCCTGCTCGC (((:::::[[[)))::::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0555 555 TCCCTGATATCCAGGGGGATCA (((([[[::::::::))))]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0552 552 AGGCCATCGCGGCCTACCGGCG (((((::[[[)))))::::]]] CP001807 Rhodothermus marinus >gb|CP001807.1| Rhodothermus marinus DSM 4252, complete genome Length=3261604 M ...
RP0556 556 AGCCTGGGCTGCTCTGCGCTC (((::[[[[:)))::::]]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0553 553 GTGTGACAGGGCTCACACGTC (((([[[:::::::))))]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0554 554 GCGTGGGCTGAAGCCACGCCCC (((([[[::::::::))))]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp ...
RP0557 557 AGGCCATCGACGCCTACCGG ((((::[[[::))))::]]] CP000769 Anaeromyxobacter sp. >gb|CP000769.1| Anaeromyxobacter sp. Fw109-5, complete genome Length=5277990 M ...
RP0558 558 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] pdb 1A60 Chain A, Nmr Structure Of A Classical Pse >pdb|1A60|A Chain A, Nmr Structure Of A Classical Pseudoknot: Interplay Of Sin ...
RP0559 559 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] AF035403 Turnip yellow mosaic Blue Lake isolat >gb|AF035403.1| Turnip yellow mosaic Blue Lake isolate, complete genome Length= ...
RP0560 560 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] TYU88850 Turnip yellow mosaic virus variant Q18 >gb|U88850.1|TYU88850 Turnip yellow mosaic virus variant Q18, virion protein (V ...
RP0561 561 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] M58313 Andean potato latent virus >gb|M58313.1|EMVRRLSZ Andean potato latent virus (APLV) 3' terminus tRNA-like s ...
RP0562 562 CGTCTATCCTGAACGTCATCAGGA (((:::[[[[[[))):::]]]]]] AF035198 Kennedya yellow mosaic virus >gb|AF035198.1| Kennedya yellow mosaic virus strain Port Douglas virion protein ...
RP0563 563 CGCTGAAACGGAGCGATATCCGT ((((...[[[[))))....]]]] X78602 peanut clump virus PKB-number PKB33 Definition:tRNA-like structure 3'end pseudoknot of RNA1 X78602 ...
RP0568 568 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865409 Homo sapiens neanderthalensis >gi|253947317|emb|FM865409.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0564 564 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865411 Homo sapiens neanderthalensis >gi|253947345|emb|FM865411.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0569 569 AGCCTTCATAGGCTATGTCCTCCCATG ((((::[[[:))))::::::::::]]] FM865409 Homo sapiens neanderthalensis >gi|253947317|emb|FM865409.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0565 565 AGCCTTCATAGGCTATGTCCTCCCATG ((((::[[[:))))::::::::::]]] FM865411 Homo sapiens neanderthalensis >gi|253947345|emb|FM865411.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0566 566 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865410 Homo sapiens neanderthalensis >gi|253947331|emb|FM865410.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0567 567 AGCCTTCATAGGCTATGTCCTCCCATG ((((::[[[:))))::::::::::]]] FM865410 Homo sapiens neanderthalensis >gi|253947331|emb|FM865410.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0570 570 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] NC_012920 Homo sapiens mitochondrion >gi|251831106|ref|NC_012920.1| Homo sapiens mitochondrion, complete genome 16569 ...

Main Database

Page 20 of 23
ID# ID Sequence Structure Organism Notes
RP0571 571 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865408 Homo sapiens neanderthalensis >gi|253947303|emb|FM865408.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0572 572 AGCCTTCATAGGCTATGTCCTCCCATG ((((::[[[:))))::::::::::]]] FM865408 Homo sapiens neanderthalensis >gi|253947303|emb|FM865408.1| Homo sapiens neanderthalensis complete mitochondri ...
RP0573 573 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] NC_011137 Homo sapiens neanderthalensis >gi|196123578|ref|NC_011137.1| Homo sapiens neanderthalensis mitochondrion, comp ...
RP0574 574 GGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGAT (((:::[[[[[[:))):::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0575 575 GCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGA ((((::[[[[[[::))))::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0576 576 TGGTGCTACAAGCTAGTACCAGTTGAGC ((((((((:::[[)))))))):::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0578 578 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0577 577 GTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATC ... ((((:[[[[[[[:::)))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]] ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0579 579 CCAGATCTGAGCCTGGGAGCTC ((((::::[[[[))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0580 580 TAAGCCTCAATAAAGCTTGCCTTGA (((((:[[[[::::)))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0581 581 CTTGCTGAAGCGCGCACGGCAAGAGGCG (((((((:::::[[[:)))))))::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0582 582 GGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGC ((((::[[[[[:::::)))):::::::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0583 583 ACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGT (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0584 584 GGATAGAGTGCATCCAGTGCAT ((((:::[[[[)))):::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0587 587 GGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCT (((::::::::::::::::[[[[[[[::::))):::::]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0589 589 TTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCT (((((((::[[[::::))))))):::::::::::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0585 585 TGCAGGGCCTATTGCACCAGGC (((((:[[[[:)))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0586 586 AAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAG ... (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]] ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0588 588 GGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAG ((((((:[[[[[[[::::::::::::))))))::::::]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0590 590 GGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTC (((((((((:[[[[[::::::)))))))))::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0591 591 TAGACAAGGAACTGTATCCTT (((::[[[[[:)))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0592 592 GCTCTATTAGATACAGGAGCAGATGATACAGTATT (((((::::[[[[[:)))))::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0593 593 TATGATCAGATACTCATAGAAATCTG (((((:[[[[[::))))):::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0594 594 GTCAACATAATTGGAAGAAATCTGTTGACTCAGATT (((((((:::::::::::[[[[))))))):::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0595 595 CTTCTGGGAAGTTCAATTAGGAATACCA (((((:[[))))):::::::::::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0596 596 TTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGA ((((((::[[[[[::::)))))):::::::::::::::::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0597 597 TTCCACAGGGATGGAAAGGATCACCAGCAATATTCC (((((::[[[[)))))::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0598 598 GTTATCTATCAATACATGGATGATTTGTAT (((((((((::[[[[)))))))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0599 599 CAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTT ((((::::::::::[[[[[[:::))))::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0600 600 CAGAAAAAGACAGCTGGACTGTC (((:::::[[[[[)))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...

Main Database

Page 21 of 23
ID# ID Sequence Structure Organism Notes
RP0601 601 CCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCT (((((:::::[[[[[::)))))::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0602 602 GGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTA (((((::::::::[[[[:))))):::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0603 603 ATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCC (((((:::::::::::::::::[[[[[)))))::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0606 606 CCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGC ((((::::[[[[[[))))::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0604 604 AGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTG ... (((((:::[[[[[[[))))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0607 607 ATGGTTTTATAGACATCACTATGAAA (((:[[[[[[[[:)))::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0605 605 GCAATTTCACCGGTGCTACGGT (((:::::[[[[:)))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0608 608 TCCCACTAGGGGATGCTAG ((((:[[[[))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0609 609 CTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAG (((((:[[[[:))))):::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0610 610 GTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGG (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0611 611 AGCTTAAGAATGAAGCTGTTAGACATTTT (((((:[[[[[[)))))::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0616 616 GGTGGAGATGGGGCACCATGCTCC ((((:::::[[[[)))):::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0613 613 GGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTT (((:[[[[[[[[:))):::::::::::::::::::::::::::::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0612 612 TCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGG (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0614 614 CCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGC ((((((:[[[))))))::::::::::::::::::::::::::::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0617 617 CCTGTGTGGAAGGAAGCAACCAC (((::[[[[:)))::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0615 615 TCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCT (((((::::::::::[[[[[[))))):::::::::::::::::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0618 618 GGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGAC ((((((((::[[[[[:::::::::::::))))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0619 619 ACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTG ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0620 620 TCCGAGATCTTCAGACCTGGAGGAGGAGAT ((((::[[[[[[:::::)))):::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0621 621 TGTTCCTTGGGTTCTTGGGAGCAGCAGGAA (((((((::::[[[[[)))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0622 622 TCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCT (((:[[[[[[)))::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0623 623 CTGGGGATTTGGGGTTGCTCTGGAAAACTC ((((((:::::[[[[[:))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0625 625 CGCAGGGGGTGGGAAGCCCT (((:[[[[))):::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0624 624 TTGAGAGACTTACTCTTGATTGTAA (((((((::[[[))))))):::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0626 626 TACAAGGAGCTTGTAGAGCT ((((((:[[)))))):::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0627 627 GCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGG ((((::[[[[))))::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0628 628 GTAGCAATACAGCAGCTACCAATGCTG (((((::::[[[[[))))):::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0629 629 TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCC ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0630 630 GCTACTTCCCTGATTAGCAGAACTACACACCAGGG ((((:::[[[[[::))))::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...

Main Database

Page 22 of 23
ID# ID Sequence Structure Organism Notes
RP0631 631 TGGTGCTACAAGCTAGTACCAGTTGAGC ((((((((:::[[)))))))):::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0632 632 TGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGC ... ((((:[[[[[[:)))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0633 633 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0634 634 CCAGATCTGAGCCTGGGAGCTC ((((::::[[[[))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0635 635 TAAGCCTCAATAAAGCTTGCCTTGA (((((:[[[[::::)))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn ...
RP0636 636 AGCCGCCAAGAGGCTAAAGTTGG ((((:[[[[::))))::::]]]] |NM_002467 Homo sapiens >ref|NM_002467.3| Homo sapiens v-myc myelocytomatosis viral oncogene homolog (a ...
RP0637 637 GGACAGTGTCAGAGTCCTGAGACA ((((::[[[[:::)))):::]]]] NC_001866 Avian myelocytomatosis virus >gi|9629900|ref|NC_001866.1| Avian myelocytomatosis virus, complete genome 3392 ...
RP0638 638 GCTGCCAAGAGGCTAAAGTTGG ((:[[[[::))):::::]]]] NM_002467 Homo sapiens >ref|NM_002467.3| Homo sapiens v-myc myelocytomatosis viral oncogene homolog (av ...
RP0639 639 GGACAGTGGCAGGGTCCTCAAACA ((((::[[:::::)))):::::]] NC_001866 Avian myelocytomatosis virus >gi|9629900|ref|NC_001866.1| Avian myelocytomatosis virus, complete genome 3392 ...
RP0641 641 CACCCCAGGCGTGATTCTGG (((:[[[[[:)))::]]]]] 00302 Avian sarcoma virus (((:[[[[[:)))::]]]]] or (((:[[[[::))):::]]]] with GU pair CACCCCAGGCGTGATTCTGG K ...
RP0640 640 CACCCCAGACGTGATTCTGG (((:[[[[[:)))::]]]]] AY350569 Avian leukosis virus >gi|493011|gb|M10455.1|ACSUR2CG UR2 sarcoma virus, complete genome 3166 bp KSPOS ...
RP0642 642 CACCCCAGACGTGGTTCTGG (((:[[[[[:)))::]]]]] K03377 Rous sarcoma virus >gb|K03377.1|ALRGENVM Rous sarcoma virus (transformation defective B77 strain) ...
RP0647 647 ATGCGATAACACGTGCATGGAAAGTGT (((((:::[[[[:))))):::::]]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 ...
RP0648 648
RP0646 646 GCAGGGGTCAGGATATGCAGCCGACCT (((:[[[[[::::::)))::::]]]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 ...
RP0645 645 GTGCTATGGGGCATTCACCA (((((:[[[))))):::]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 ...
RP0643 643 CCCATTGCATTTGGGTAAATGTA ((((:[[[[[[))))::]]]]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 ...
RP0644 644 GAGCAATTGAGCTCAGTGTCA ((((:::[[[))))::::]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 ...
RP0649 649 TGCGATAACACGTGCATGGAAAGTGT (((((:::[[[[:)))))::::]]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 ...
RP0650 650 CATGGTGGTGGCTGGGGGCAACCCCATGGTGGCGGCTG ((((::::::::::::::[[:[[:)))):::::]]:]] AY765383 Brachyteles arachnoides prion >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe ...
RP0651 651 CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] AY765383 Brachyteles arachnoides prion >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe ...
RP0652 652 CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] U15164 APU15164 Ateles paniscus >gb|U15164.1|APU15164 Ateles paniscus x Ateles fusciceps major prion protein pr ...
RP0653 653 CATGGTGGTGGCTGGGGGCAACCCCATGGTGGCGGCTG ((((::::::::::::::[[:[[:)))):::::]]:]] U15164 APU15164 Ateles paniscus >gb|U15164.1|APU15164 Ateles paniscus x Ateles fusciceps major prion protein pr ...
RP0654 654 CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] U08309 AGU08309 Ateles geoffroyi prion >gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cdsSeq compa ...
RP0655 655 CATGGTGGCGGCTGGGGACAGCCTCATGGTGGTGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] U08309 AGU08309 Ateles geoffroyi prion >gb|U08309.1|AGU08309 Ateles geoffroyi prion protein gene, partial cdsSeq compa ...
RP0656 656 CATGGTGGCGGCTGGGGACAGCCCCATGGTGGCGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] XM_002747325 Callithrix jacchus >ref|XM_002747325.1| PREDICTED: Callithrix jacchus major prion protein-like, tr ...
RP0657 657 AATAAGAGGCTTTGTATCTCTTATTGAATCTTTAGTAATAGGCATACAAA (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]] C. botulinum NC_010520 viral read though like KSPOS J.Lynn 04/19/2011
RP0658 658 AATTACTTTTATTATTTAAGTAATTTGGCTTTTTATATAAATAAT ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]] C. botulinum NC_010520 viral read though like KSPOS J.Lynn 04/19/2011
RP0659 659 TCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC (((((:[[[[[[[)))))::::::::::::::::::::::]]]]]]] DQ399707 Xenotropic MuLV >gi|88765817|gb|DQ399707.1| Xenotropic MuLV-related virus VP62, complete genome ...
RP0660 660 CCTTTATCTGAGGGTCTACCAGA (((((:[[[)))))::::::]]] NC016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...

Main Database

Page 23 of 23
ID# ID Sequence Structure Organism Notes
RP0665 665 GAGGACACCACCACCGGGGAACCTTCCACCTCCCT ((((:::::::::::[[[[[:)))):::::]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0662 662 GTAGTTTCAGCTTTTGCAGCTGCGACAGAAGT ((((((:::[[[[[[[:))))))::]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0663 663 AAACATGAGTATGGCAGAATGGGTGTTTAAATGCTGTA ((((((:::[[[[[[[::::::)))))):::]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0661 661 CTACAAATATTTCTGTGCAGGTAGAGACAGAGCATAG ((((::::::::[[[[[[::)))):::::::]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0666 666 GCCCTAGCTCTACCACGAGGCACGGTAGA (((:::::[[[[[[::::)))::]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0664 664 AAAATGTAAATATTATTTCATTTTTAACTGCTTTGCGTTTTATGTTTAAAGGTG ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0667 667 TGTACAAGATATATACCGTTCATGTGCACAAGGTG ((((((:::::::[[[[:::::)))))):::]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0668 668 GTTGAAGGCTCAACATGGGCT (((((:[[[)))))::::]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0669 669 GGCATCACACACAGATGCTGATGT ((((((::::[[[))))))::]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0670 670 ATATAGGTGATCCAGAATATATAGAACTGGA (((((:::::[[[[[::)))))::::]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0671 671 GGTTGTGCTCCAGCCTTAGGGC (((((:[[[[))))):::]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0672 672 GGGGTAATAACTTGTTTGTTACCTTTTTGGATAA ((((((((((:[[[[)))))))))):::::]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0673 673 AGCTTATTTTGCAGCTGTGTAAGAT ((((:[[[[[[[))))::]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...
RP0674 674 AGCCTTTGTACCGGGAGTGGTTGCATTTTTGG ((((::::::[[[[[[[[))))::]]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja ...