Main Database

Page 1 of 7
ID# ID Sequence Structure Organism Notes
RP0001 1 GCTGAGCCAGCAGCAGATGGGGTGG ((((::[[[:))))::::::::]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 H0001 James F.Lynn 01-06-09 KSNEG:GCTGAGCCAGCAGCAGATGGggtgg ...
RP0002 2 AAAGTTGTCCCTTTGACTGACACGAC ((((::[[[:)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 ...
RP0003 3 TCAACTGCTGTTGAATGGCAGTCTAGC ((((::[[[:))))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA James F.Lynn ...
RP0004 4 ATTAAATAAAATAGTAAGAATGTAT (((::[[[:)))::::::::::]]] A07108 HIV >A07108 H0004 James F.Lynn 01-06-09 KSNEG
RP0005 5 ACAAGGAACTGTATCCTTTAACTTC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 ...
RP0006 6 AAGTTGTCCCTTTGACTGACACGAC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn ...
RP0007 7 AGTTGTCACCCTAACTGAC (((([[[:::::))))]]] A04321|HIVLAIJ19 H0007 James F.Lynn 01-08-09 >A04321|HIVLAIJ19 KSNEG
RP0008 8 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A07108 HIV >A07108 (appears twice)Human immunodeficiency virus type 1 (LAV.ELI) proviral D ...
RP0009 9 AAAATCTTAGAGCCTTTTAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 ge ...
RP0010 10 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
RP0011 11 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A07108 HIV >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG
RP0012 12 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
RP0013 13 GCTGCCAGAAAAAGACAGCTGG (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 RSNEG
RP0014 14 GATTGTTTTTCAGAATCTGCTATAAGAAA ((((:::[[[:::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0015 15 AGCCATTACACAGGCTTGTCCAAAGGTA ((((::[[[:::)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn ...
RP0016 16 GGAATTTGGAATTCCCTACAATCCCCA ((((::[[[::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0017 17 GCACCACTAATGTGCCCTGGAACTCTAG ((((::[[[::))))::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0018 18 CAAAGGTATCCTTTGAGCCAATTCCCATA ((((::[[[::)))):::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 ...
RP0021 21 TCCAGAAGCGCTGGAAGGGCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0022 22 TTAACCTCAGAATAAGATTGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0023 23 TCTAGTAGTCATAGACTCACT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0020 20 AAGCATGTCATGTATATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0019 19 CATTCCATTCTGATGATAAAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0027 27 AGAGTGTCTCAATCTGGTAGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0028 28 CCCATGGGGACGGGGTAGCCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0029 29 GCCAGCCGCTCGGGCTCCGCG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0030 30 GAAGGTAACGAATTCTCCGTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0026 26 TGGAAGCCTAAGCCAAGAAGG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0025 25 TTTTGACTTCGTAAAAATAAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0024 24 AGTTAAGTAAAGACTGGTTAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0033 33 GCATCCCTTTCCTGCATAAAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0034 34 CTTGGATTCGAGAAGACGGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0035 35 GATCATTTCGAGATCTTCGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0032 32 ACACTCTCAACTTGTAGATGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0031 31 GCCGCAAAAGGGGGCCGCTTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0036 36 TCAGAGAAGTTTTGACCGCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0037 37 ATATCAATATTATATATATAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0038 38 ATAGGATTAGATCTTTCTTAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0039 39 GCGTACTATGGATCTCTTACG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0040 40 GACTCTCCTTTCGTCATAAGG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0041 41 CCTTCCAGAACCAGGGGGTCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0042 42 TTATTACTCGACTAAAAGGAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0055 55 CGACTTTGTTCGTCGTGTACA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0043 43 GCTATGAAGCTTAGCCTTCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0044 44 AGAAACGACATCTCTTATGTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0045 45 CTTTTATTCATGAAGAAAGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0046 46 GGAGAGGAGTGATCCAAGCTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0047 47 CTTTCCAATAAGAAGATCATT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0048 48 TCTTTTTTTTGAAGAAAGAAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0049 49 ATTTATCATCAGAATGGAATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0050 50 AACAGACTAGTCGTTCAGTAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0051 51 CAACCGTCTTGATTGAATAGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0052 52 TCTTTCACTATTAGATTCAGT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0053 53 ATATCTATTATTTATAATAAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0054 54 TCTCCTAGAGAAAGAAGTTCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0056 56 CGCTGCCTACACGCGAATTAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0057 57 CTCAATATATACGAGTGTTAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0058 58 ACGTCGGAACCGCGTGAGTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0059 59 GGGGCTGTTAAGCCCAAGAAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0060 60 GACTCCGCGAACGTCCCGCGC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0061 61 GGCATGATCAAAGCCGATGAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0062 62 GCGGCCCATAGGCGCGAGATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0063 63 CCCACAACCAAAGGGAGTGGT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0064 64 GGGTCCGAGCTTCCCAAGCTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0065 65 TTATCTTTAAGATAATGGTAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0066 66 AAAAAAGGGGGCTTTGTTCCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0067 67 AAATCGGTACACTTTTAGTAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0068 68 CCCCTTGAAGTAGGGGGTTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0069 69 CTTGACTGAGCAAAGAAGTCA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0070 70 TTAATAATCAAATAATAAGAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0071 71 CTTAGGAAGAAAAAGGCTCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0072 72 TTGAAAGAAAGACAAAACTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0073 73 TGTTCCTCGGATACAATTCGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0074 74 CTTTCGGGCGAGAAGCAGGCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0075 75 ACCAGTTCATATTTGGTTACT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 ...
RP0076 76 CGCTGAAACGGAGCGATATCCGT (((::::[[[[[))):::]]]]] X78602 peanut clump virus PKB-number: PKB33
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of ...
RP0077 77 CCCTAACCGCGGGTAAGCGG (((:::[[[[))):::]]]] M25782 satellite tobacco mosaic virus PKB-number: PKB22 Definition: tRNA-like structure 3'end pseudoknot of satellit ...
RP0078 78 CCGTAACCGCCGGTAGCGG (((:::[[[[)))::]]]] M34077 tobacco mild green mosaic virus PKB-number: PKB23 Definition: tRNA-like structure 3'end pseudoknot of tobacco ...
RP0079 79 CCTTTACCCCGGGTATGGGG (((:::[[[[))):::]]]] X72586 paprika mild mottle virus PKB-number: PKB24 Definition: tRNA-like structure 3'end pseudoknot of paprika ...
RP0080 80 GGGGGGACTTAGCGCCCCCCAAACCGT ((((((:::::[[[))))))::::]]] AF033818 Bovine Leukemia Virus PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke ...
RP0101 101 ACTCAGTATTGTGCCTGAGTGATGGCA ((((((:::::[[[))))))::::]]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA12-25-08 Jame ...
RP0102 102 GAGACCTCCAGTGGGTCTCTAGGGGCACACCCACT ((((((:::[[[[))))))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0002 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) ...
RP0103 103 TTTCAGGTGGCGTCTGAAAAGACTCGCCAGACGC ((((((:::[[[[)))))):::::::::::]]]] Bovine Leukemia Virus AF033818 M0003 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) ...
RP0104 104 CCCTGTCAGTGGGGCTCACTG (((:::[[[[)))::::]]]] Bovine Leukemia Virus AF033818 M0004 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[)))::::]] ...
RP0105 105 GGGACCCTGACCCAACAATCAG (((:::[[[[))):::::]]]] Bovine Leukemia Virus AF033818 M0005 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::] ...
RP0106 106 GGTGCGAGAAACCATTCATTCT (((:::[[[[))):::::]]]] Bovine Leukemia Virus AF033818 M0006 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::] ...
RP0113 113 TGCAGGCTTGTGCACATTGGGCCCCCAAG ((((::[[[[)))):::::::::::]]]] Bovine Leukemia Virus AF033818 M0013 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((::[[[[)))):::: ...
RP0112 112 AGACCTCCAGTGGGTCTCTAGGGGCACACCCAC ((((:::::[[[[))))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0012 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((:::::[[[[)))): ...
RP0111 111 AACTGCCCCCTTCCGGCCGTTCGCGCTCAGCCCGGCC (((:::::::::::[[[[)))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0011 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::::::::::[[[[ ...
RP0110 110 GTCGCCCAGAACCGACGGGGGCTTGATTGGTT (((::::::[[[[)))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0010 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((::::::[[[[))):: ...
RP0109 109 TCAGGTGGCGTCTGAAAAGACTCGCCAGACG (((:::::[[[[)))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0009 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::::[[[[)))::: ...
RP0107 107 GGTGGCTAGGACCTCTCCCGGCCCTA (((:::[[[[))):::::::::]]]] Bovine Leukemia Virus AF033818 M0007 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::: ...
RP0108 108 GGTGCGAGAAACCATTCATTCTGTTCT (((:::[[[[)))::::::::::]]]] Bovine Leukemia Virus AF033818 M0008 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::[[[[))):::::: ...
RP0125 125 ACACATGCCTGTGTACCCACAG (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0025
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0126 126 AATCTGTAGTAATTAATTGTAC (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0026
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0127 127 GATGTATAAATATCACTGCATT (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0027
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0129 129 ATGATAAATACCATAGTAATGTA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0030
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0128 128 ACTTGAAGGAGAGTGAGAGACTC (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0028
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...
RP0130 130 CCCCCCTTGGAGGGTATCCAAG (((::[[[[[[)))::]]]]]] D30753 potato mop-top virus PKB-number: PKB32
Definition: tRNA-like structure 3'end pseudoknot of RNA2 of ...
RP0131 131 AAAACTCAAAATTTAAAAATTTT (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0031
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st ...