Loading .....
Search for:                         Details found: 674     Page 1 of 7      Records Per Page:
Logged on as Guest

Log out
ID# ID Sequence Structure Organism Notes
View RP0648 648        
View RP0175 175 CCTCTCTCCCTAGCCTCCGCTCTTAGGACGGGGATCAAGAGAGGTCAAACCCAAAAGAG (((((((((((::(((:::[[[[[)))::))))::::)))))))::::::::::]]]]] U68074 E.coli PKB-number: PKB50 Definition: Pseudoknot PK2 of E.coli tmRNA Organism: E.coli More ...
View RP0177 177 GTTTGTTAGTGGCGTGTCCGTCCGCAGCTGGCAAGCGAATGTAAAGACTGAC ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]] U68074 E.coli PKB-number: PKB52 Definition: Pseudoknot PK4 of E.coli tmRNA Organism: E.coli More ...
View RP0664 664 AAAATGTAAATATTATTTCATTTTTAACTGCTTTGCGTTTTATGTTTAAAGGTG ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0672 672 GGGGTAATAACTTGTTTGTTACCTTTTTGGATAA ((((((((((:[[[[)))))))))):::::]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0598 598 GTTATCTATCAATACATGGATGATTTGTAT (((((((((::[[[[)))))))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0590 590 GGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTC (((((((((:[[[[[::::::)))))))))::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0657 657 AATAAGAGGCTTTGTATCTCTTATTGAATCTTTAGTAATAGGCATACAAA (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]] C. botulinum NC_010520 viral read though like KSPOS J.Lynn 04/19/2011
View RP0576 576 TGGTGCTACAAGCTAGTACCAGTTGAGC ((((((((:::[[)))))))):::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0631 631 TGGTGCTACAAGCTAGTACCAGTTGAGC ((((((((:::[[)))))))):::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0618 618 GGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGAC ((((((((::[[[[[:::::::::::::))))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0209 209 GGGTTCGGACCCCCTCCCCGAACCTAGGGTAACACTGACTGUGGAGGGG ((((((((::[[[[[[[)))))))):::::::::::::::::]]]]]]] M26927 gibbon ape leukemia virus PKB-number: PKB79
Definition: Gag/pol translational readthrough site of gibbo More ...
View RP0658 658 AATTACTTTTATTATTTAAGTAATTTGGCTTTTTATATAAATAAT ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]] C. botulinum NC_010520 viral read though like KSPOS J.Lynn 04/19/2011
View RP0172 172 GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] AF033811 Moloney murine leukemia virus PKB-number: PKB47 Definition: Gag/pol translational readthrough site of Molone More ...
View RP0208 208 GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCACTGTCGGGGGGC ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] J01998 AKV murine leukemia virus PKB-number: PKB78
Definition: Gag/pol translational readthrough site of AKV m More ...
View RP0594 594 GTCAACATAATTGGAAGAAATCTGTTGACTCAGATT (((((((:::::::::::[[[[))))))):::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0612 612 TCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGG (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0581 581 CTTGCTGAAGCGCGCACGGCAAGAGGCG (((((((:::::[[[:)))))))::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0182 182 TGTGTCTTGGATCGCGCGGGTCAAATGTATATGGTTCATATACATCCGCAGGCACGTAATAAAGCGA (((((((::::[[[[((((:::::((((((((:::::))))))))))))))))))):::::::]]]] J02415 tobacco mosaic virus PKB-number: PKB57 Definition: tRNA-like structure bulge pseudoknot of tobacco More ...
View RP0621 621 TGTTCCTTGGGTTCTTGGGAGCAGCAGGAA (((((((::::[[[[[)))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0421 421 AGTGGGTCTCTAGGGGCACACCCACTACCCGCCGGCCCCT (((((((::::[[[[[[::)))))))::::::::]]]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
View RP0610 610 GTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGG (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0624 624 TTGAGAGACTTACTCTTGATTGTAA (((((((::[[[))))))):::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0589 589 TTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCT (((((((::[[[::::))))))):::::::::::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0459 459 GGCTTCCTGCGGAAGCCAGGC (((((((:[[)))))))::]] NC_010317 Abaca bunchy top virus >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
View RP0173 173 GGGTTCTCCCGCCCTCCGTGAACCCAGGCTAAAAGTTAAGGTAGGGGGGC ((((((:(::[[[[[[[):))))))::::::::::::::::::]]]]]]] M54993 spleen necrosis virus PKB-number: PKB48 Definition: Gag/pol translational readthrough site of spleen More ...
View RP0629 629 TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCC ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0667 667 TGTACAAGATATATACCGTTCATGTGCACAAGGTG ((((((:::::::[[[[:::::)))))):::]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0416 416 GGGGGGACTTAGCGCCCCCCAAACCG ((((((::::::[[))))))::::]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
View RP0423 423 ACTCAGTATTGTGCCTGAGTGATGGC ((((((::::::[[))))))::::]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa More ...
View RP0080 80 GGGGGGACTTAGCGCCCCCCAAACCGT ((((((:::::[[[))))))::::]]] AF033818 Bovine Leukemia Virus PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke More ...
View RP0101 101 ACTCAGTATTGTGCCTGAGTGATGGCA ((((((:::::[[[))))))::::]]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA12-25-08 Jame More ...
View RP0441 441 CCACACAAATAATTGTGTGGTCCCAAT ((((((:::::[[[))))))::::]]] Chayote yellow mosaic virus NC_004618 >gi|29028717|ref|NC_004618.1| Chayote yellow mosaic virus, complete genome Compu More ...
View RP0623 623 CTGGGGATTTGGGGTTGCTCTGGAAAACTC ((((((:::::[[[[[:))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0669 669 GGCATCACACACAGATGCTGATGT ((((((::::[[[))))))::]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0102 102 GAGACCTCCAGTGGGTCTCTAGGGGCACACCCACT ((((((:::[[[[))))))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0002 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) More ...
View RP0082 82 GGGGCTCAAGGGAGGCCCCAGAAACAAACTTTCCC ((((((:::[[[[))))))::::::::::::]]]] AF033820 Equine Infectious Anemic Virus PKB-number: PKB3 Definition: Gag-pol ribosomal frameshift site of Equine Infec More ...
View RP0103 103 TTTCAGGTGGCGTCTGAAAAGACTCGCCAGACGC ((((((:::[[[[)))))):::::::::::]]]] Bovine Leukemia Virus AF033818 M0003 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((((:::[[[[)))))) More ...
View RP0422 422 TCCGGGATTGATCACCCCGGAACCCTAACGATC ((((((:::[[[[::))))))::::::::]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
View RP0662 662 GTAGTTTCAGCTTTTGCAGCTGCGACAGAAGT ((((((:::[[[[[[[:))))))::]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0663 663 AAACATGAGTATGGCAGAATGGGTGTTTAAATGCTGTA ((((((:::[[[[[[[::::::)))))):::]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0619 619 ACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTG ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0170 170 TTCCGGTCGACTCCGGAGAAACAAAGTC ((((((::[[[[))))))::::::]]]] L04573 pea enation mosaic virus PKB-number: PKB45
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras More ...
View RP0434 434 GAGTCCATAATTGGACTCATTCAAAATT ((((((::[[[[))))))::::::]]]] Australian bat lyssavirus AF418014 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
View RP0596 596 TTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGA ((((((::[[[[[::::)))))):::::::::::::::::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0626 626 TACAAGGAGCTTGTAGAGCT ((((((:[[)))))):::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0614 614 CCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGC ((((((:[[[))))))::::::::::::::::::::::::::::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0181 181 TAACGTTGATAGTGTTGAACTATC ((((((:[[[[)))))):::]]]] U34586 odontoglossum ringspot virus PKB-number: PKB56 Definition: Pseudoknot PK1 of the upstream pseudoknot domain More ...
View RP0457 457 GAGGATTACTTGAATTACGGAATTCTGAGGAATTCAAG ((((((:[[[[:[[[::::)))))):::::]]]:]]]] NC_010319 Abaca bunchy top virus >gi|167006434|ref|NC_010319.1| Abaca bunchy top virus DNA-R, complete genome Com More ...
View RP0588 588 GGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAG ((((((:[[[[[[[::::::::::::))))))::::::]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0586 586 AAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAG More ... (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]] More ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0603 603 ATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCC (((((:::::::::::::::::[[[[[)))))::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0615 615 TCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCT (((((::::::::::[[[[[[))))):::::::::::::::::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0602 602 GGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTA (((((::::::::[[[[:))))):::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0116 116 AAAGAAATAGCTGTCTTTTATCCAG (((((:::::[[[)))))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0016
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0295 295 GGATTTCTTCAATAATCCCCCCATT (((((:::::[[[)))))::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
View RP0329 329 AATTAACAAATTATAATTGGCTTAA (((((:::::[[[)))))::::]]] AJ577589 Human echovirus 11 computational-sequence comparison James F. lynn 08-19-2009 >AJ577589 ~7312-7433
View RP0362 362 GATATTGGAGTGAATATCTTGATCA (((((:::::[[[)))))::::]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
View RP0377 377 GGGGGCCGGAGGCCCCCCGGTGGCC (((((:::::[[[)))))::::]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
View RP0460 460 TAGAGGATCAGCCGACTCTATAAATATAGGGAGGC (((((:::::[[[::)))))::::::::::::]]] NC_010317 Abaca bunchy top virus >gi|167006430|ref|NC_010317.1| Abaca bunchy top virus DNA-M, complete genome Com More ...
View RP0462 462 GTATTTAAATATTTAAATACCAAACCTTAAGGAAT (((((:::::[[[::)))))::::::::::::]]] NC_010315 Abaca bunchy top virus segment 2 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen More ...
View RP0463 463 TATATTAAATATAACATATAAAATATATAAGGTAT (((((:::::[[[::)))))::::::::::::]]] NC_010315 Abaca bunchy top virus segment 2 >gi|167006427|ref|NC_010315.1| Abaca bunchy top virus segment 2, complete sequen More ...
View RP0464 464 GCGGCTACCGCAGGTGCCGCGCGAGCGGCGTACTG (((((:::::[[[::)))))::::::::::::]]] AF009606 Hepatitis C virus Computational James F. Lynn 05/30/2010 >gi|2316097|gb|AF009606.1|AF009606 Hepati More ...
View RP0465 465 TTGAGGAGCTTGCTGCTCAAGAACTAATAGCAGCA (((((:::::[[[::)))))::::::::::::]]] AF218039 Cricket paralysis virus Computational James F. Lynn 05/30/2010 >gi|8895506|gb|AF218039.1|AF218039 Cricke More ...
View RP0466 466 ATGTTAACAAGAATGAACATTTCTGATCTTACTTC (((((:::::[[[::)))))::::::::::::]]] DQ113899 Adult diarrheal rotavirus Computational James F. Lynn 05/30/2010 >gi|69145430|gb|DQ113899.1| Adult diarrhe More ...
View RP0467 467 TGTTAAGAACCTGTTTAACACTTTCACAATGTCAG (((((:::::[[[::)))))::::::::::::]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
View RP0578 578 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0633 633 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0601 601 CCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCT (((((:::::[[[[[::)))))::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0670 670 ATATAGGTGATCCAGAATATATAGAACTGGA (((((:::::[[[[[::)))))::::]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0628 628 GTAGCAATACAGCAGCTACCAATGCTG (((((::::[[[[[))))):::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0592 592 GCTCTATTAGATACAGGAGCAGATGATACAGTATT (((((::::[[[[[:)))))::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0583 583 ACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGT (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0647 647 ATGCGATAACACGTGCATGGAAAGTGT (((((:::[[[[:))))):::::]]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
View RP0649 649 TGCGATAACACGTGCATGGAAAGTGT (((((:::[[[[:)))))::::]]]] H1N1 HA HM624086 H1N1 HA HM624086 >gi|300117091|gb|HM624086.1| Influenza A virus (A/Perth/260/20 More ...
View RP0604 604 AGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTG More ... (((((:::[[[[[[[))))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: More ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0552 552 AGGCCATCGCGGCCTACCGGCG (((((::[[[)))))::::]]] CP001807 Rhodothermus marinus >gb|CP001807.1| Rhodothermus marinus DSM 4252, complete genome Length=3261604 M More ...
View RP0169 169 GGCGGCGGCGACCGCCGAAACAACCGC (((((::[[[:)))))::::::::]]] X76931 cucurbit aphid-borne yellows virus PKB-number: PKB44
Definition: ORF2/ORF3 (putative RNA-dependent RNA polymeras More ...
View RP0270 270 GAAAACTTTTTTTTTCCGCTAGTAAAA (((((::[[[:)))))::::::::]]] DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational J More ...
View RP0267 267 TGCATACGATAATGCATAGTGGCTATC (((((::[[[:)))))::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
View RP0268 268 TGTACACGATAGTACATAGTGTTTATC (((((::[[[:)))))::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
View RP0278 278 ATCTGGAATATCAGATAGGATACATAT (((((::[[[:)))))::::::::]]] CY043336.1| Influenza A virus >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme More ...
View RP0287 287 TAATTAGAACTAATTATGTGAATGGTT (((((::[[[:)))))::::::::]]] DQ113897.1| Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
View RP0303 303 ATGGGGACAGCCCCATGGTGGTGGCTG (((((::[[[:)))))::::::::]]] M33958 >M33958 computational-sequence comparison James F. lynn 08-19-2009
View RP0371 371 CGGGGGGGGGGCCCCGGGGGGTCCCCC (((((::[[[:)))))::::::::]]] NC_001944 Beak and feather disease virus method: computational James F. Lynn 10-25-09 >gi|9630729|ref|NC_001944.1| Beak a More ...
View RP0442 442 AGTCCATAATTGGACTCATTCAAAATT (((((::[[[:)))))::::::::]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
View RP0443 443 TCTCTCAGATCAGAGATCTTTTCAATC (((((::[[[:)))))::::::::]]] AF418014 Australian bat lyssavirus >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
View RP0205 205 CGAGAAGGAGATCTCTCGTAAATAAGACTC (((((::[[[:[[))))):::::::]]]]] U68079 Legionella pneumophila PKB-number: PKB67
Definition: Pseudoknot PK1 of Legionella pneumophila tmRNA
More ...
View RP0597 597 TTCCACAGGGATGGAAAGGATCACCAGCAATATTCC (((((::[[[[)))))::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0171 171 GGCGGCGGCGTCCGCCGTAACAAACGC (((((::[[[[))))):::::::]]]] L25299 barley yellow dwarf virus PKB-number: PKB46 Definition: ORF2/ORF3 (putative RNA-dependent RNA polymerase More ...
View RP0081 81 CGCGGCACCGTCCGCGGAACAAACGG (((((::[[[[)))))::::::]]]] X13063 Beet Western-Yellows Virus PKB-number: PKB2 Modification: 1999-6-21 Definition: Orf2-orf3 ribosomal f More ...
View RP0361 361 CTGGAGGAACAATCCAGCGGATATTTGTT (((((::[[[[[))))):::::::]]]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
View RP0083 83 GGGGCGAGCTGCAGCCCCAGTGAATCAAATGCAGC (((((::[[[[[[))))):::::::::::]]]]]] M25381 Feline Immunodeficiency Virus PKB-number: PKB4 Definition: Gag-pol ribosomal frameshift site of Feline Imm More ...
View RP0595 595 CTTCTGGGAAGTTCAATTAGGAATACCA (((((:[[))))):::::::::::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0332 332 CCTCGACCTTGAGGGAATGCTAAAGG (((((:[[[))))):::::::::]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
View RP0660 660 CCTTTATCTGAGGGTCTACCAGA (((((:[[[)))))::::::]]] NC016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0512 512 CCCTCTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] X16378 turnip yellow mosaic virus Computational James F. Lynn 06/05/2010 KSPOS
View RP0558 558 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] pdb 1A60 Chain A, Nmr Structure Of A Classical Pse >pdb|1A60|A Chain A, Nmr Structure Of A Classical Pseudoknot: Interplay Of Sin More ...
View RP0559 559 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] AF035403 Turnip yellow mosaic Blue Lake isolat >gb|AF035403.1| Turnip yellow mosaic Blue Lake isolate, complete genome Length= More ...
View RP0560 560 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] TYU88850 Turnip yellow mosaic virus variant Q18 >gb|U88850.1|TYU88850 Turnip yellow mosaic virus variant Q18, virion protein (V More ...
[ 1 2 3 4 5 6 7 ]