Loading .....
Search for:                         Details found: 674     Page 1 of 7      Records Per Page:
Logged on as Guest

Log out
ID# ID Sequence Structure Organism Notes
View RP0648 648        
View RP0138 138 ACCAGAAAAAGGGTGGCTCAGTACTT (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0262 262 GGCAGATTTAATCAGCCAGAATTAAA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
View RP0659 659 TCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC (((((:[[[[[[[)))))::::::::::::::::::::::]]]]]]] DQ399707 Xenotropic MuLV >gi|88765817|gb|DQ399707.1| Xenotropic MuLV-related virus VP62, complete genome More ...
View RP0451 451 TGTAACTATGTACACAGCTAATAG ((((:[[[[:))))::::::]]]] DQ113897 Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
View RP0261 261 TTAAATTATATTAATAAATTTTTATA (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
View RP0066 66 AAAAAAGGGGGCTTTGTTCCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0477 477 AAAAATATTTTAAATA (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
View RP0123 123 AAAACTCAAAATTTAAAAATTT (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0023
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0131 131 AAAACTCAAAATTTAAAAATTTT (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0031
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0413 413 AAAACTTTTTTTTTCCGCTAGTAAAA ((((:[[[[:))))::::::::]]]] DQ192570 Crow polyomavirus >gi|77820254|gb|DQ192570.1| Crow polyomavirus, complete genome Computational Jam More ...
View RP0292 292 AAAAGAGAAGTTTGACGCCTTC (((:::[[[[))):::::]]]] NC_009597 Pyrococcus abyssi virus method: computational James F. Lynn 10-23-2009 >gi|149274319|ref|NC_009597.1| P More ...
View RP0365 365 AAAATATTTCTTTTACAGATGCAAAA ((((::[[[:)))):::::::::]]] NC_007013 Small anellovirus 1 method: computational James F. Lynn 10-25-09 >gi|66391749|ref|NC_007013.1| Small More ...
View RP0009 9 AAAATCTTAGAGCCTTTTAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 ge More ...
View RP0664 664 AAAATGTAAATATTATTTCATTTTTAACTGCTTTGCGTTTTATGTTTAAAGGTG ((((((((((::::::::[[[[[[[[[::::))))))))))::::]]]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0431 431 AAACACATTACTGTTTTATCAAGTA (((:::::[[[[:))):::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome C More ...
View RP0663 663 AAACATGAGTATGGCAGAATGGGTGTTTAAATGCTGTA ((((((:::[[[[[[[::::::)))))):::]]]]]]] NC_016157 Human papillomavirus >gi|358356460|ref|NC_016157.1| Human papillomavirus type 126, complete genome Ja More ...
View RP0116 116 AAAGAAATAGCTGTCTTTTATCCAG (((((:::::[[[)))))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0016
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0226 226 AAAGATACTCTTTGAGAGGAGT (((:::[[[[))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
View RP0194 194 AAAGGACGATCTTTCGCGATCG (((:::[[[[[:::)))]]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
View RP0201 201 AAAGGACGATCTTTCGCGATCG ((((::[[[[))))::::]]]] X82130.1 Odontoglossum ringspot virus >gi|558231|emb|X82130.1 Odontoglossum ringspot virus RNA for replicase,
moveme More ...
View RP0189 189 AAAGGGGTTTTTAACC (((::[[[)))::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen More ...
View RP0357 357 AAAGGGTGGAACTGCTTTGGATCATCTTTCC ((((:::[[[[:::)))):::::::::]]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
View RP0002 2 AAAGTTGTCCCTTTGACTGACACGAC ((((::[[[:)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0212 212 AAAGTTTGTGTTTCTAAAACACA (((:::[[[[)))::::::]]]] X02144 tobacco mosaic virus PKB-number: PKB82
Definition: Pseudoknot PK1 of the upstream pseudoknot domai More ...
View RP0228 228 AAATAAAAAGTTATTATTTATATTACTT ((((:::[[[[::::)))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
View RP0067 67 AAATCGGTACACTTTTAGTAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0198 198 AAATCTCTGAATTTATTAATTTATCAG ((((::[[[[)))):::::::::]]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase,
movem More ...
View RP0265 265 AAATCTCTGAATTTATTAATTTATCAG ((((::[[[:))))::::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
View RP0500 500 AAATTATATTTCATAT (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
View RP0050 50 AACAGACTAGTCGTTCAGTAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0448 448 AACATAATGGTGTTTGGACACATT ((((:[[[[:))))::::::]]]] X52374 Berne virus mRNA >gi|58776|emb|X52374.1| Berne virus mRNA for polymerase Computational James F. L More ...
View RP0250 250 AACATCTTTTTGTTGCAGAAAAA (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
View RP0531 531 AACCTGAATCCCAGGTTGATGAAGCGGGATGGG ((((:::::[[[[))))::::::::::::]]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
View RP0568 568 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865409 Homo sapiens neanderthalensis >gi|253947317|emb|FM865409.1| Homo sapiens neanderthalensis complete mitochondri More ...
View RP0564 564 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865411 Homo sapiens neanderthalensis >gi|253947345|emb|FM865411.1| Homo sapiens neanderthalensis complete mitochondri More ...
View RP0566 566 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865410 Homo sapiens neanderthalensis >gi|253947331|emb|FM865410.1| Homo sapiens neanderthalensis complete mitochondri More ...
View RP0570 570 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] NC_012920 Homo sapiens mitochondrion >gi|251831106|ref|NC_012920.1| Homo sapiens mitochondrion, complete genome 16569 More ...
View RP0571 571 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] FM865408 Homo sapiens neanderthalensis >gi|253947303|emb|FM865408.1| Homo sapiens neanderthalensis complete mitochondri More ...
View RP0573 573 AACCTTTTAAGTTAAAGATTAA (((:::[[[[))):::::]]]] NC_011137 Homo sapiens neanderthalensis >gi|196123578|ref|NC_011137.1| Homo sapiens neanderthalensis mitochondrion, comp More ...
View RP0111 111 AACTGCCCCCTTCCGGCCGTTCGCGCTCAGCCCGGCC (((:::::::::::[[[[)))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0011 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 (((:::::::::::[[[[ More ...
View RP0408 408 AACTTCCTGGCAATCAGTTGGA (((([[[::::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0383 383 AACTTCCTGGCAATCAGTTGGA (((([[[::::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0188 188 AACTTTAGGTTTCCTA (((::[[[)))::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, movemen More ...
View RP0476 476 AAGAGATTCTTCAAAT (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
View RP0281 281 AAGCAGCTTCATCAGCTTTTAAAAAAGTGAA ((((:::[[[[:::)))):::::::::]]]] DQ113899.1| Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat More ...
View RP0020 20 AAGCATGTCATGTATATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0506 506 AAGCATTCCTTTTGAA (((::[[[)))::]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye S More ...
View RP0285 285 AAGCGTTCTTTGCTTATGAAAAAG ((((:::[[[[)))):::::]]]] DQ113897.1| Adult diarrheal rotavirus >gi|69145385|gb|DQ113897.1| Adult diarrheal rotavirus strain J19 VP1 Computatio More ...
View RP0284 284 AAGCTCCTGATGCTTTTGATTGGTCACAG ((((::[[[::)))):::::::::::]]] DQ113898.1| Adult diarrheal rotavirus >gi|69145407|gb|DQ113898.1| Adult diarrheal rotavirus strain J19 VP2 Computati More ...
View RP0011 11 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A07108 HIV >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG
View RP0012 12 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
View RP0586 586 AAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAG More ... (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]] More ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0393 393 AAGGTACTGGGACCCTTACTGTCCCTCCA ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0006 6 AAGTTGTCCCTTTGACTGACACGAC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn More ...
View RP0338 338 AAGTTTGATAAGACTTGGACTATGCAATC ((((::[[[:::))))::::::::::]]] NC_013116 Sclerotinia sclerotiorum hypovirulence a method: computational James F. Lynn 10-23-2009 >gi|256352170|ref|NC_013116.1| Sc More ...
View RP0657 657 AATAAGAGGCTTTGTATCTCTTATTGAATCTTTAGTAATAGGCATACAAA (((((((((:[[[[[[))))))))):::::::::::::::::::]]]]]] C. botulinum NC_010520 viral read though like KSPOS J.Lynn 04/19/2011
View RP0248 248 AATAATTTAAAATTGAAATTTAA (((:::[[[[:))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
View RP0420 420 AATATATGGGTAGATTCCAAATACC (((:::::[[[[:))):::::]]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
View RP0264 264 AATATGTCTTACACTATTACA (((([[[:::::::))))]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
View RP0351 351 AATCACAAGGGTGATTTGT (((([[[:::::))))]]] NC_003871 Carrot red leaf luteovirus method: computational James F. Lynn 10-24-2009 >gi|20889313|ref|NC_003871.1| Car More ...
View RP0470 470 AATCCCCCATTTGGGG (((::[[[)))::]]] AY729654 Sudan ebolavirus >gi|52352969|gb|AY729654 Sudan ebolavirus strain Gulu, complete genome 18,875 C More ...
View RP0277 277 AATCTCAATATGGATTAGCCACTCAATT ((((::[[[:::)))):::::::::]]] CY043336.1| Influenza A virus >gi|255103456|gb|CY043336.1| Influenza A virus (A/Denmark/523/2009(H1N1)) segme More ...
View RP0432 432 AATCTCATCCATTTCGTGGGAT (((:::[[[[))):::::]]]] Australian bat lyssavirus AF418014 >gi|22726511|gb|AF418014.1| Australian bat lyssavirus, complete genome LOCUS More ...
View RP0436 436 AATCTCATCCATTTCGTGGGAT (((:::[[[[))):::::]]]] Eupatorium yellow vein virus AB433979 >gi|195963299|dbj|AB433979.1| Eupatorium yellow vein virus- [Japan: Kagawa: Toma More ...
View RP0126 126 AATCTGTAGTAATTAATTGTAC (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0026
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0280 280 AATGAAAATTCATTGATTAACTATT ((((::[[[:))))::::::::]]] DQ113899.1| Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat More ...
View RP0136 136 AATGCTGATAGATTTTAGGGAACTA (((:::::[[[)))::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0120 120 AATGGCAGTTCATTGCATGAA (((:::::[[[)))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0020
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0329 329 AATTAACAAATTATAATTGGCTTAA (((((:::::[[[)))))::::]]] AJ577589 Human echovirus 11 computational-sequence comparison James F. lynn 08-19-2009 >AJ577589 ~7312-7433
View RP0658 658 AATTACTTTTATTATTTAAGTAATTTGGCTTTTTATATAAATAAT ((((((((::[[[[[[[)))))))):::::::::::::]]]]]]] C. botulinum NC_010520 viral read though like KSPOS J.Lynn 04/19/2011
View RP0282 282 AATTATCAACGCGGAAATTGAT (((([[[::::::::))))]]] DQ113899.1| Adult diarrheal rotavirus >gi|69145430|gb|DQ113899.1| Adult diarrheal rotavirus strain J19 VP4 Computat More ...
View RP0263 263 AATTTAAAATTGAAATTTAAATATTT (((:::[[[[::::))):::::]]]] AP000545 Homo sapiens >gi|5931523|dbj|AP000545 Homo sapiens genomic DNA, chromosome 22q11.2, Cat Eye More ...
View RP0272 272 AATTTACTTTTTCAATTGATGAAAATTGTGAAA ((((:::::[[[[))))::::::::::::]]]] DQ249299 Duck hepatitis virus >gi|82468324|gb|DQ249299.1| Duck hepatitis virus 1 strain 03D, complete sequenc More ...
View RP0005 5 ACAAGGAACTGTATCCTTTAACTTC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0125 125 ACACATGCCTGTGTACCCACAG (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0025
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0547 547 ACACCCACCCGTGTGTGTTCGGCTTGCGG (((:::::[[[)))::::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
View RP0032 32 ACACTCTCAACTTGTAGATGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0132 132 ACAGATACTTGTGTTTAATACAA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0358 358 ACAGCACGTAGAAACTGTACCAGGAGCCTAC ((((:::[[[[:::)))):::::::::]]]] NC_007193 Chaetoceros salsugineum method: computational James F. Lynn 10-23-2009 >gi|86476036|ref|NC_007193.2| Cha More ...
View RP0137 137 ACAGTTTTAATTGTGGAGGGGAATT (((:::::[[[)))::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0446 446 ACCAATGTGATGGTATTTTCACACA ((((:[[[[:)))):::::::]]]] EU420138 Bat coronavirus >gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome More ...
View RP0347 347 ACCACCTCAGATGGTTCTTGGAACAGTGA ((((::[[[::)))):::::::::::]]] NC_012958 Drosophila A virus method: computational James F. Lynn 10-23-2009 >gi|253761971|ref|NC_012958.1| Dr More ...
View RP0075 75 ACCAGTTCATATTTGGTTACT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0379 379 ACCATCGGCATGGTGGAGATGGGCC ((((::[[[:))))::::::::]]] NC_001427 Chicken anemia virus method: computational James F. Lynn 10-25-09 >gi|9626429|ref|NC_001427.1| Chicke More ...
View RP0353 353 ACCGTCCCCTCGGTAATGGCGAATGGG ((((::[[[:))))::::::::::]]] NC_001653 Hepatitis delta virus method: computational James F. Lynn 10-23-2009 >gi|13277517|ref|NC_001653.2| Hep More ...
View RP0538 538 ACCTGAATCCCAGGTTGATGAAGCGGGAT ((((::[[[::)))):::::::::::]]] GU979419 Spissistilus festinus virus >gi|300432042|gb|GU979419.1| Spissistilus festinus virus 1, complete genome Comp More ...
View RP0369 369 ACCTGGAGGAGGAGGTTTTGCCT ((((:::::[[[))))::::]]] NC_007014 Small anellovirus 2 method: computational James F. Lynn 10-25-09 >gi|66391753|ref|NC_007014.1| Small More ...
View RP0058 58 ACGTCGGAACCGCGTGAGTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0423 423 ACTCAGTATTGTGCCTGAGTGATGGC ((((((::::::[[))))))::::]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA Computationa More ...
View RP0101 101 ACTCAGTATTGTGCCTGAGTGATGGCA ((((((:::::[[[))))))::::]]] X13063 Turnip yellows virus >gi|62294|emb|X13063.1| Turnip yellows virus (BWYV-FL1) genomic RNA12-25-08 Jame More ...
View RP0266 266 ACTGTTCAACAGCAGTTTGCTGATGTTTG ((((::[[[:::))))::::::::::]]] X82130 Odontoglossum ringspot virus >gi|558231|emb|X82130.1| Odontoglossum ringspot virus RNA for replicase, moveme More ...
View RP0619 619 ACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTG ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0128 128 ACTTGAAGGAGAGTGAGAGACTC (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0028
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0583 583 ACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGT (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0372 372 ACTTTTAATAAAGTGAAGTGGTATT ((((::[[[:))))::::::::]]] NC_002068 Bovine circovirus method: computational James F. Lynn 10-25-09 >gi|9631282|ref|NC_002068.1| Bovine More ...
View RP0044 44 AGAAACGACATCTCTTATGTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0487 487 AGACAGAGTCTCTCTC (((::[[[)))::]]] AF253314 Homo sapiens >gi|10945419|gb|AF253314.1|AF253314 Homo sapiens pheromone receptor (PHB4C5) ps More ...
View RP0112 112 AGACCTCCAGTGGGTCTCTAGGGGCACACCCAC ((((:::::[[[[))))::::::::::::]]]] Bovine Leukemia Virus AF033818 M0012 Bovine Leukemia Virus AF033818 James F. Lynn 12-25-08 ((((:::::[[[[)))): More ...
View RP0027 27 AGAGTGTCTCAATCTGGTAGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
[ 1 2 3 4 5 6 7 ]