Loading .....
Search for:                         Details found: 674     Page 1 of 7      Records Per Page:
Logged on as Guest

Log out
ID# ID Sequence Structure Organism Notes
View RP0648 648        
View RP0214 214 AGTGTTTTTCCCTCCACTTAAATCGAAGGG ((((:::::[[[[[))))::::::]:]]]] X02144 tobacco mosaic virus PKB-number: PKB84
Definition: Pseudoknot PK3 of the upstream pseudoknot domai More ...
View RP0211 211 GCGATTTCTGACCGCTTTTTTGTCAG (((::::[[[[[)))::::::]]]]] * PKB-number: PKB81
Definition: Oligonucleotide PK5
Organism:
Abbreviation: More ...
View RP0641 641 CACCCCAGGCGTGATTCTGG (((:[[[[[:)))::]]]]] 00302 Avian sarcoma virus (((:[[[[[:)))::]]]]] or (((:[[[[::))):::]]]] with GU pair CACCCCAGGCGTGATTCTGG K More ...
View RP0385 385 CTTGCCCCCCCAAGCGTTAATGAAGGG ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0386 386 TTTATTGTTAAAAATAAACAA (((([[[:::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0387 387 TTTAATTGCCGTAATAAAAAT (((([[[:::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0388 388 CATCGGTATAATGATCAGTATA (((:::[[[[))):::::]]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0389 389 ATCACCTAATGAGTGATGAGCCCATT ((((:::[[[[::)))):::::]]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0390 390 ATTGATGGCCAGCAATTCCTCTG ((((:::::[[[))))::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0391 391 CAGTAAACTACACTGAAAATACATCAAGT ((((::[[[::)))):::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0392 392 CTGTCCTGCCACAGGAGTCCACAAGCA ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0393 393 AAGGTACTGGGACCCTTACTGTCCCTCCA ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0394 394 AGGATGTTTGTCCTACTCTCAGAAAA ((((::[[[:)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0395 395 TAAGTCACAGCTTAGTCAATTATGT ((((::[[[:))))::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0396 396 CTTGCCCCCCCAAGCGTTAATGAAGGG ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0397 397 CAAACTCCCATTTGGGCCTTGAGGG ((((::[[[:))))::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0398 398 TGTTGAGATAGGAACACCAAGCTAT ((((:::[[[[:)))):::::]]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0399 399 CAAAAGTATACTGTTTGAACCCCTAGTAT ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0400 400 TTCAGACATTGCGTGAACTCCTCCTTAAT ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0401 401 GAAATTTTTCTTTTTCATTGAAG ((((:::::[[[))))::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0402 402 ATTGGCAATCAATAAACCTCTTGATT ((((::[[[))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0403 403 CCTGTAACTTCAGGCCTATTTCAGT ((((::[[[:))))::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0404 404 ATTACTCCGGTAATATTGTGCATCGG ((((::[[[:)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0405 405 TGAAACAAGATCCTTCACAACCCACTTCT ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0406 406 GACACTCAAGTGTCATGTCCAGGTTG ((((::[[[:)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0407 407 TATCGATTATGTTGATAATGTAAATAATA ((((:::[[[:::)))):::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0408 408 AACTTCCTGGCAATCAGTTGGA (((([[[::::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0383 383 AACTTCCTGGCAATCAGTTGGA (((([[[::::::::))))]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0384 384 CTGTCCTGCCACAGGAGTCCACAAGCA ((((::[[[:))))::::::::::]]] 52352969 ebolavirus >gi|52352969|gb|AY729654.1| Sudan ebolavirus strain Gulu, complete genome James More ...
View RP0217 217 TTAGCCACTTTTTAAAAGAAAAG (((::::[[[[[))):::]]]]] >A07108 HIV >A07108 hiv James F.Lynn 08-09-2009
View RP0218 218 AGTACACATCCCACTAGGGGATG (((:::[[[[[[)))::]]]]]] >A07108 HIV >A07108 HIV James F.Lynn 08-09-2009
View RP0135 135 TACAGAAGTTAGTAGGAGTATTAA (((:::::[[[))):::::::]]] >gi|2828036|gb|AF038398.1|AF03839 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0132 132 ACAGATACTTGTGTTTAATACAA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0133 133 GTAATTAATTGTACAAGACCCAA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0134 134 ATAGGAGGTTTTATTAATACTAAA (((:::::[[[))):::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0136 136 AATGCTGATAGATTTTAGGGAACTA (((:::::[[[)))::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0137 137 ACAGTTTTAATTGTGGAGGGGAATT (((:::::[[[)))::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0138 138 ACCAGAAAAAGGGTGGCTCAGTACTT (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0139 139 GGAGCTAATTTTCCAGGTTTGGCAAA (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0140 140 TTTATGGGATGAAAGCCTAAAGCCAT (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0141 141 GTAATTAATTGTACAAGACCCAACAA (((:::::[[[))):::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0142 142 GACAATCAGTGGTCTTATAAAATTCAC (((:::::[[[)))::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0143 143 GGACCTCCTCCTCCTCCCCCTCCAGGA (((:::::[[[)))::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0144 144 CACTCTATTTTGTGCATCAGATGCTAAA (((:::::[[[))):::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0145 145 CCAAAGACATTTGGCTGGCTATGGAAAT (((:::::[[[))):::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0146 146 TTGCTGCACCTCAATTCTCTCTTTGGAGG (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0147 147 CTTAGCACTGAAAGTAGTAAGCGATGTCA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0148 148 CCTCCCCCTCCAGGACTAGCATAAATGGA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0149 149 TAACAAAAGCCTTAGGCATCTCCTATGGC (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0150 150 GTAATTAATTGTACAAGACCCAACAACAA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0151 151 TCACTCTCTTGTGAGGGACAGAAATACAA (((:::::[[[)))::::::::::::]]] >gi|2828036|gb|AF038398.1|AF038398 HIV >gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus strain SH More ...
View RP0125 125 ACACATGCCTGTGTACCCACAG (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0025
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0126 126 AATCTGTAGTAATTAATTGTAC (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0026
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0127 127 GATGTATAAATATCACTGCATT (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0027
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0129 129 ATGATAAATACCATAGTAATGTA (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0030
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0128 128 ACTTGAAGGAGAGTGAGAGACTC (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0028
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0131 131 AAAACTCAAAATTTAAAAATTTT (((:::::[[[)))::::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0031
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0116 116 AAAGAAATAGCTGTCTTTTATCCAG (((((:::::[[[)))))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0016
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0117 117 TTTGTTTCATAACAAAAGCCTTA ((((:::::[[[))))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0017
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0122 122 CAGAGGATTTGCTGCACCTCAA (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0022
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0123 123 AAAACTCAAAATTTAAAAATTT (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0023
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0124 124 TTGTTTCATAACAAAAGCCTTA (((:::::[[[))):::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0024
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0118 118 CAATTCTCTCTTTGGAGGAGA (((:::::[[[)))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0019
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0119 119 CAATTCTCTCTTTGGAGGAGA (((:::::[[[)))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0019
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0120 120 AATGGCAGTTCATTGCATGAA (((:::::[[[)))::::]]] >gi|2828036|gb|AF038398.1|AF038398 Simian-Human im M0020
>gi|2828036|gb|AF038398.1|AF038398 Simian-Human immunodeficiency virus st More ...
View RP0510 510 GCTGAGCCAGCAGCAGATGG ((((::[[[:)))):::]]] A04321 HIVLAIJ19 Computational KSPOS James F. Lynn 06/05/2010 present in all hiv genomes
View RP0001 1 GCTGAGCCAGCAGCAGATGGGGTGG ((((::[[[:))))::::::::]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 H0001 James F.Lynn 01-06-09 KSNEG:GCTGAGCCAGCAGCAGATGGggtgg More ...
View RP0007 7 AGTTGTCACCCTAACTGAC (((([[[:::::))))]]] A04321|HIVLAIJ19 H0007 James F.Lynn 01-08-09 >A04321|HIVLAIJ19 KSNEG
View RP0009 9 AAAATCTTAGAGCCTTTTAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 ge More ...
View RP0010 10 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
View RP0012 12 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
View RP0013 13 GCTGCCAGAAAAAGACAGCTGG (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 RSNEG
View RP0002 2 AAAGTTGTCCCTTTGACTGACACGAC ((((::[[[:)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0003 3 TCAACTGCTGTTGAATGGCAGTCTAGC ((((::[[[:))))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA James F.Lynn More ...
View RP0004 4 ATTAAATAAAATAGTAAGAATGTAT (((::[[[:)))::::::::::]]] A07108 HIV >A07108 H0004 James F.Lynn 01-06-09 KSNEG
View RP0005 5 ACAAGGAACTGTATCCTTTAACTTC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0006 6 AAGTTGTCCCTTTGACTGACACGAC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn More ...
View RP0008 8 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A07108 HIV >A07108 (appears twice)Human immunodeficiency virus type 1 (LAV.ELI) proviral D More ...
View RP0011 11 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A07108 HIV >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG
View RP0014 14 GATTGTTTTTCAGAATCTGCTATAAGAAA ((((:::[[[:::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0015 15 AGCCATTACACAGGCTTGTCCAAAGGTA ((((::[[[:::)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn More ...
View RP0016 16 GGAATTTGGAATTCCCTACAATCCCCA ((((::[[[::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0017 17 GCACCACTAATGTGCCCTGGAACTCTAG ((((::[[[::))))::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0018 18 CAAAGGTATCCTTTGAGCCAATTCCCATA ((((::[[[::)))):::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0309 309 CGGTCGGCAACCGTCCTTTTGAATGC ((((::[[[))))::::::::::]]] AAVN02000007 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009 ( More ...
View RP0317 317 CGGTCGGCAACCGTCCTTTTGAATGC ((((::[[[))))::::::::::]]] AAVN02000007 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009
View RP0454 454 GCAAAAAACATTGCTGCCACGATGTT (((:::[[[[[[[:)))::]]]]]]] AB290918 Torque teno midi virus >dbj|AB290918.1| Torque teno midi virus 1 DNA, complete genome, isolate: MD1-07 More ...
View RP0452 452 GCAAAAAACATTGCTGCCACAATGTT (((:::[[[[[[[:)))::]]]]]]] AB290924 Torque teno midi virus >dbj|AB290924.1| Torque teno midi virus ORF1 gene for hypothetical protein, par More ...
View RP0302 302 GAAGAAGTATTTCATCTGATAT (((::::[[[)))::::::]]] AC148022 Homo sapiens >gb|AC148022.2| Homo sapiens BAC clone RP11-1383G16 from 2, complete sequence More ...
View RP0301 301 GAAGAAGTATTTCATCTGATAT (((::::[[[)))::::::]]] AC183531 Pan troglodytes >gb|AC183531.2 Pan troglodytes BAC clone CH251-637O1 from chromosome 2, complet More ...
View RP0541 541 AGGCCATTGCCGCCTATCGGCG ((((:::[[[[)))):::]]]] AE000516 Mycobacterium tuberculosis >gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length=4403 More ...
View RP0464 464 GCGGCTACCGCAGGTGCCGCGCGAGCGGCGTACTG (((((:::::[[[::)))))::::::::::::]]] AF009606 Hepatitis C virus Computational James F. Lynn 05/30/2010 >gi|2316097|gb|AF009606.1|AF009606 Hepati More ...
View RP0478 478 AGTCCCTCACTGAGAG (((::[[[)))::]]] AF009606 Hepatitis C virus >gi|2316097|gb|AF009606 AF009606 Hepatitis C virus Computational James F. Lynn 0 More ...
View RP0210 210 GGGGCAGTCCCCTAGCCCCGCTCAAAAGGGGGAT (((((:[[[[[[[:)))))::::::::]]]]]]] AF033807 mouse mammary tumor viru PKB-number: PKB80
Definition: Gag/pro ribosomal frameshift site of mouse mamm More ...
View RP0172 172 GGGTCAGGAGCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGC ((((((((:[[[[[[[)))):))))::::::::::::::::::]]]]]]] AF033811 Moloney murine leukemia virus PKB-number: PKB47 Definition: Gag/pol translational readthrough site of Molone More ...
View RP0080 80 GGGGGGACTTAGCGCCCCCCAAACCGT ((((((:::::[[[))))))::::]]] AF033818 Bovine Leukemia Virus PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke More ...
View RP0275 275 TTTCAGACCCCCTTGACTGACAACCAAG (:((((:::::[[[::)))):):::]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational More ...
View RP0415 415 GGTGGTTCTCGGCTGAGACCGCCGCGAGC ((:(((:::::[[[:::))):)):::]]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
View RP0416 416 GGGGGGACTTAGCGCCCCCCAAACCG ((((((::::::[[))))))::::]] AF033818 Bovine leukemia virus >gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome Computational 0 More ...
[ 1 2 3 4 5 6 7 ]