Loading .....
Search for:                         Details found: 674     Page 1 of 7      Records Per Page:
Logged on as Guest

Log out
ID# ID Sequence Structure Organism Notes
View RP0648 648        
View RP0307 306 AGGTTCCCTCAACCTGGTTGGTAATCAGG ((((::[[[::)))):::::::::::]]] AM711867 >AM711867 computational-sequence comparison James F. lynn 08-19-2009 -2868776
View RP0641 641 CACCCCAGGCGTGATTCTGG (((:[[[[[:)))::]]]]] 00302 Avian sarcoma virus (((:[[[[[:)))::]]]]] or (((:[[[[::))):::]]]] with GU pair CACCCCAGGCGTGATTCTGG K More ...
View RP0001 1 GCTGAGCCAGCAGCAGATGGGGTGG ((((::[[[:))))::::::::]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 H0001 James F.Lynn 01-06-09 KSNEG:GCTGAGCCAGCAGCAGATGGggtgg More ...
View RP0009 9 AAAATCTTAGAGCCTTTTAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 ge More ...
View RP0010 10 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
View RP0012 12 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
View RP0013 13 GCTGCCAGAAAAAGACAGCTGG (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 RSNEG
View RP0008 8 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A07108 HIV >A07108 (appears twice)Human immunodeficiency virus type 1 (LAV.ELI) proviral D More ...
View RP0004 4 ATTAAATAAAATAGTAAGAATGTAT (((::[[[:)))::::::::::]]] A07108 HIV >A07108 H0004 James F.Lynn 01-06-09 KSNEG
View RP0006 6 AAGTTGTCCCTTTGACTGACACGAC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn More ...
View RP0011 11 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A07108 HIV >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG
View RP0217 217 TTAGCCACTTTTTAAAAGAAAAG (((::::[[[[[))):::]]]]] >A07108 HIV >A07108 hiv James F.Lynn 08-09-2009
View RP0218 218 AGTACACATCCCACTAGGGGATG (((:::[[[[[[)))::]]]]]] >A07108 HIV >A07108 HIV James F.Lynn 08-09-2009
View RP0003 3 TCAACTGCTGTTGAATGGCAGTCTAGC ((((::[[[:))))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA James F.Lynn More ...
View RP0015 15 AGCCATTACACAGGCTTGTCCAAAGGTA ((((::[[[:::)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn More ...
View RP0002 2 AAAGTTGTCCCTTTGACTGACACGAC ((((::[[[:)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0005 5 ACAAGGAACTGTATCCTTTAACTTC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0017 17 GCACCACTAATGTGCCCTGGAACTCTAG ((((::[[[::))))::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0014 14 GATTGTTTTTCAGAATCTGCTATAAGAAA ((((:::[[[:::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0016 16 GGAATTTGGAATTCCCTACAATCCCCA ((((::[[[::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0018 18 CAAAGGTATCCTTTGAGCCAATTCCCATA ((((::[[[::)))):::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0317 317 CGGTCGGCAACCGTCCTTTTGAATGC ((((::[[[))))::::::::::]]] AAVN02000007 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009
View RP0309 309 CGGTCGGCAACCGTCCTTTTGAATGC ((((::[[[))))::::::::::]]] AAVN02000007 >AAVN02000007 ~7607 computational-sequence comparison James F. lynn 08-19-2009 ( More ...
View RP0574 574 GGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGAT (((:::[[[[[[:))):::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0575 575 GCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGA ((((::[[[[[[::))))::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0576 576 TGGTGCTACAAGCTAGTACCAGTTGAGC ((((((((:::[[)))))))):::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0578 578 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0577 577 GTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATC More ... ((((:[[[[[[[:::)))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::]] More ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0579 579 CCAGATCTGAGCCTGGGAGCTC ((((::::[[[[))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0580 580 TAAGCCTCAATAAAGCTTGCCTTGA (((((:[[[[::::)))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0581 581 CTTGCTGAAGCGCGCACGGCAAGAGGCG (((((((:::::[[[:)))))))::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0582 582 GGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGC ((((::[[[[[:::::)))):::::::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0583 583 ACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGT (((((::::[[[[[[[[[)))))::::::::::::::::::::::::::::::::]]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0584 584 GGATAGAGTGCATCCAGTGCAT ((((:::[[[[)))):::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0587 587 GGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCT (((::::::::::::::::[[[[[[[::::))):::::]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0589 589 TTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCT (((((((::[[[::::))))))):::::::::::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0585 585 TGCAGGGCCTATTGCACCAGGC (((((:[[[[:)))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0586 586 AAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAG More ... (((((::::::::::::::::::[[[[[::::))))):::::::::::::::::::::::::::::::::::::::::]] More ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0588 588 GGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAG ((((((:[[[[[[[::::::::::::))))))::::::]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0590 590 GGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTC (((((((((:[[[[[::::::)))))))))::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0591 591 TAGACAAGGAACTGTATCCTT (((::[[[[[:)))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0592 592 GCTCTATTAGATACAGGAGCAGATGATACAGTATT (((((::::[[[[[:)))))::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0593 593 TATGATCAGATACTCATAGAAATCTG (((((:[[[[[::))))):::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0594 594 GTCAACATAATTGGAAGAAATCTGTTGACTCAGATT (((((((:::::::::::[[[[))))))):::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0595 595 CTTCTGGGAAGTTCAATTAGGAATACCA (((((:[[))))):::::::::::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0596 596 TTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGA ((((((::[[[[[::::)))))):::::::::::::::::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0597 597 TTCCACAGGGATGGAAAGGATCACCAGCAATATTCC (((((::[[[[)))))::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0598 598 GTTATCTATCAATACATGGATGATTTGTAT (((((((((::[[[[)))))))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0599 599 CAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTT ((((::::::::::[[[[[[:::))))::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0600 600 CAGAAAAAGACAGCTGGACTGTC (((:::::[[[[[)))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0601 601 CCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCT (((((:::::[[[[[::)))))::::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0602 602 GGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTA (((((::::::::[[[[:))))):::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0603 603 ATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCC (((((:::::::::::::::::[[[[[)))))::::::::::::::::::::::::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0606 606 CCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGC ((((::::[[[[[[))))::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0604 604 AGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTG More ... (((((:::[[[[[[[))))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: More ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0607 607 ATGGTTTTATAGACATCACTATGAAA (((:[[[[[[[[:)))::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0605 605 GCAATTTCACCGGTGCTACGGT (((:::::[[[[:)))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0608 608 TCCCACTAGGGGATGCTAG ((((:[[[[))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0609 609 CTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAG (((((:[[[[:))))):::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0610 610 GTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGG (((((((::::[[[[[[::::))))))):::::::::::::::::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0611 611 AGCTTAAGAATGAAGCTGTTAGACATTTT (((((:[[[[[[)))))::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0616 616 GGTGGAGATGGGGCACCATGCTCC ((((:::::[[[[)))):::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0613 613 GGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTT (((:[[[[[[[[:))):::::::::::::::::::::::::::::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0612 612 TCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGG (((((((::::::[[[[[[[[))))))):::::::::::::::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0614 614 CCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGC ((((((:[[[))))))::::::::::::::::::::::::::::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0617 617 CCTGTGTGGAAGGAAGCAACCAC (((::[[[[:)))::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0615 615 TCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCT (((((::::::::::[[[[[[))))):::::::::::::::::::::::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0618 618 GGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGAC ((((((((::[[[[[:::::::::::::))))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0619 619 ACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTG ((((((:::[[[[[[[[:::::)))))):::::]]]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0620 620 TCCGAGATCTTCAGACCTGGAGGAGGAGAT ((((::[[[[[[:::::)))):::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0621 621 TGTTCCTTGGGTTCTTGGGAGCAGCAGGAA (((((((::::[[[[[)))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0622 622 TCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCT (((:[[[[[[)))::::::::::::::::::]]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0623 623 CTGGGGATTTGGGGTTGCTCTGGAAAACTC ((((((:::::[[[[[:))))))::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0625 625 CGCAGGGGGTGGGAAGCCCT (((:[[[[))):::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0624 624 TTGAGAGACTTACTCTTGATTGTAA (((((((::[[[))))))):::]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0626 626 TACAAGGAGCTTGTAGAGCT ((((((:[[)))))):::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0627 627 GCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGG ((((::[[[[))))::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0628 628 GTAGCAATACAGCAGCTACCAATGCTG (((((::::[[[[[))))):::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0629 629 TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCC ((((((:::::::::::::::::[[[[[::::::::))))))::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0630 630 GCTACTTCCCTGATTAGCAGAACTACACACCAGGG ((((:::[[[[[::))))::::::::::::]]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0631 631 TGGTGCTACAAGCTAGTACCAGTTGAGC ((((((((:::[[)))))))):::::]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0632 632 TGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGC More ... ((((:[[[[[[:)))):::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: More ... HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0633 633 CCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGC (((((:::::[[[[))))):::::::::::::::::::::::::::::::::::::::::::::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0634 634 CCAGATCTGAGCCTGGGAGCTC ((((::::[[[[))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0635 635 TAAGCCTCAATAAAGCTTGCCTTGA (((((:[[[[::::)))))::]]]] HIV K03455 >B.FR.83.HXB2_LAI_IIIB_BRT.K03455 9719 HIV K03455 Computational James F. Lynn More ...
View RP0305 305 AGGTTCCCTCAACCTGGACGGCAATCAGG ((((::[[[::)))):::::::::::]]] BX842576 >BX842576/93135-93242 computational-sequence comparison James F. lynn 08-19-2009
View RP0304 304 AGGTTCCCTCAACCTGGACGGCAATCAGG ((((::[[[::)))):::::::::::]]] CP000511 >CP000511 ~3501682 computational-sequence comparison James F. lynn 08-19-2009
View RP0454 454 GCAAAAAACATTGCTGCCACGATGTT (((:::[[[[[[[:)))::]]]]]]] AB290918 Torque teno midi virus >dbj|AB290918.1| Torque teno midi virus 1 DNA, complete genome, isolate: MD1-07 More ...
View RP0452 452 GCAAAAAACATTGCTGCCACAATGTT (((:::[[[[[[[:)))::]]]]]]] AB290924 Torque teno midi virus >dbj|AB290924.1| Torque teno midi virus ORF1 gene for hypothetical protein, par More ...
View RP0522 522 AGGCCATCGCCGCCTACCGGCG ((((:::[[[[)))):::]]]] AP010918 Mycobacterium bovis >dbj|AP010918.1| Mycobacterium bovis BCG str. Tokyo 172 DNA, complete genome Le More ...
View RP0540 540 AGGCCATTGCCGCCTATCGGCG ((((:::[[[[)))):::]]]] AM408590 Mycobacterium bovis >emb|AM408590.1| Mycobacterium bovis BCG Pasteur 1173P2, complete genome Length More ...
View RP0302 302 GAAGAAGTATTTCATCTGATAT (((::::[[[)))::::::]]] AC148022 Homo sapiens >gb|AC148022.2| Homo sapiens BAC clone RP11-1383G16 from 2, complete sequence More ...
View RP0301 301 GAAGAAGTATTTCATCTGATAT (((::::[[[)))::::::]]] AC183531 Pan troglodytes >gb|AC183531.2 Pan troglodytes BAC clone CH251-637O1 from chromosome 2, complet More ...
View RP0541 541 AGGCCATTGCCGCCTATCGGCG ((((:::[[[[)))):::]]]] AE000516 Mycobacterium tuberculosis >gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length=4403 More ...
View RP0562 562 CGTCTATCCTGAACGTCATCAGGA (((:::[[[[[[))):::]]]]]] AF035198 Kennedya yellow mosaic virus >gb|AF035198.1| Kennedya yellow mosaic virus strain Port Douglas virion protein More ...
View RP0559 559 CCCTTTTCCGAGGGTCATCGGA (((((:[[[))))):::::]]] AF035403 Turnip yellow mosaic Blue Lake isolat >gb|AF035403.1| Turnip yellow mosaic Blue Lake isolate, complete genome Length= More ...
View RP0453 453 GCAAAAAACATTGCTGCCACAATGTT (((:::[[[[[[[:)))::]]]]]]] AY622911 Small anellovirus >gb|AY622911.1| Small anellovirus 1 genomic sequence Length=372 James F. Lynn 0 More ...
View RP0650 650 CATGGTGGTGGCTGGGGGCAACCCCATGGTGGCGGCTG ((((::::::::::::::[[:[[:)))):::::]]:]] AY765383 Brachyteles arachnoides prion >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe More ...
View RP0651 651 CATGGTGGCGGCTGGGGGCAGCCCCATGGTGGCGGCTG ((((::::::::::::::[[[[[:)))):::::]]]]] AY765383 Brachyteles arachnoides prion >gb|AY765383.1| Brachyteles arachnoides prion protein (PrP) gene, partial cdsSe More ...
[ 1 2 3 4 5 6 7 ]