Loading .....
Search for:                         Details found: 674     Page 1 of 7      Records Per Page:
Logged on as Guest

Log out
ID# ID Sequence Structure Organism Notes
View RP0001 1 GCTGAGCCAGCAGCAGATGGGGTGG ((((::[[[:))))::::::::]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 H0001 James F.Lynn 01-06-09 KSNEG:GCTGAGCCAGCAGCAGATGGggtgg More ...
View RP0002 2 AAAGTTGTCCCTTTGACTGACACGAC ((((::[[[:)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0003 3 TCAACTGCTGTTGAATGGCAGTCTAGC ((((::[[[:))))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA James F.Lynn More ...
View RP0004 4 ATTAAATAAAATAGTAAGAATGTAT (((::[[[:)))::::::::::]]] A07108 HIV >A07108 H0004 James F.Lynn 01-06-09 KSNEG
View RP0005 5 ACAAGGAACTGTATCCTTTAACTTC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn 0 More ...
View RP0006 6 AAGTTGTCCCTTTGACTGACACGAC (((::[[[:)))::::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNAJames F.Lynn More ...
View RP0007 7 AGTTGTCACCCTAACTGAC (((([[[:::::))))]]] A04321|HIVLAIJ19 H0007 James F.Lynn 01-08-09 >A04321|HIVLAIJ19 KSNEG
View RP0008 8 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A07108 HIV >A07108 (appears twice)Human immunodeficiency virus type 1 (LAV.ELI) proviral D More ...
View RP0009 9 AAAATCTTAGAGCCTTTTAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19 James F.Lynn 01-08-09 This motif is found in 100% of HIV1 ge More ...
View RP0010 10 GGTCTCTCTGGTTAGACCAGA (((([[[:::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
View RP0011 11 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A07108 HIV >A07108 (appears twice)James F.Lynn 01-08-09 KSNEG
View RP0012 12 AAGCTTGCCTTGAGTGCTTCAA (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 KSNEG
View RP0013 13 GCTGCCAGAAAAAGACAGCTGG (((([[[::::::::))))]]] A04321|HIVLAIJ19 >A04321|HIVLAIJ19James F.Lynn 01-08-09 RSNEG
View RP0014 14 GATTGTTTTTCAGAATCTGCTATAAGAAA ((((:::[[[:::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0015 15 AGCCATTACACAGGCTTGTCCAAAGGTA ((((::[[[:::)))):::::::::]]] A07108 HIV >A07108 Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn More ...
View RP0016 16 GGAATTTGGAATTCCCTACAATCCCCA ((((::[[[::)))):::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0017 17 GCACCACTAATGTGCCCTGGAACTCTAG ((((::[[[::))))::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0018 18 CAAAGGTATCCTTTGAGCCAATTCCCATA ((((::[[[::)))):::::::::::]]] A07108 HIV >A07108Human immunodeficiency virus type 1 (LAV.ELI) proviral DNA.James F.Lynn 0 More ...
View RP0019 19 CATTCCATTCTGATGATAAAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0020 20 AAGCATGTCATGTATATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0021 21 TCCAGAAGCGCTGGAAGGGCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0022 22 TTAACCTCAGAATAAGATTGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0023 23 TCTAGTAGTCATAGACTCACT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0024 24 AGTTAAGTAAAGACTGGTTAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0025 25 TTTTGACTTCGTAAAAATAAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0026 26 TGGAAGCCTAAGCCAAGAAGG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0027 27 AGAGTGTCTCAATCTGGTAGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0028 28 CCCATGGGGACGGGGTAGCCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0029 29 GCCAGCCGCTCGGGCTCCGCG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0030 30 GAAGGTAACGAATTCTCCGTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0031 31 GCCGCAAAAGGGGGCCGCTTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0032 32 ACACTCTCAACTTGTAGATGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0033 33 GCATCCCTTTCCTGCATAAAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0034 34 CTTGGATTCGAGAAGACGGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0035 35 GATCATTTCGAGATCTTCGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0036 36 TCAGAGAAGTTTTGACCGCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0037 37 ATATCAATATTATATATATAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0038 38 ATAGGATTAGATCTTTCTTAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0039 39 GCGTACTATGGATCTCTTACG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0040 40 GACTCTCCTTTCGTCATAAGG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0041 41 CCTTCCAGAACCAGGGGGTCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0042 42 TTATTACTCGACTAAAAGGAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0043 43 GCTATGAAGCTTAGCCTTCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0044 44 AGAAACGACATCTCTTATGTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0045 45 CTTTTATTCATGAAGAAAGAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0046 46 GGAGAGGAGTGATCCAAGCTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0047 47 CTTTCCAATAAGAAGATCATT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0048 48 TCTTTTTTTTGAAGAAAGAAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0049 49 ATTTATCATCAGAATGGAATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0050 50 AACAGACTAGTCGTTCAGTAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0051 51 CAACCGTCTTGATTGAATAGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0052 52 TCTTTCACTATTAGATTCAGT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0053 53 ATATCTATTATTTATAATAAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0054 54 TCTCCTAGAGAAAGAAGTTCT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0055 55 CGACTTTGTTCGTCGTGTACA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0056 56 CGCTGCCTACACGCGAATTAG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0057 57 CTCAATATATACGAGTGTTAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0058 58 ACGTCGGAACCGCGTGAGTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0059 59 GGGGCTGTTAAGCCCAAGAAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0060 60 GACTCCGCGAACGTCCCGCGC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0061 61 GGCATGATCAAAGCCGATGAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0062 62 GCGGCCCATAGGCGCGAGATG (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0063 63 CCCACAACCAAAGGGAGTGGT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0064 64 GGGTCCGAGCTTCCCAAGCTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0065 65 TTATCTTTAAGATAATGGTAA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0066 66 AAAAAAGGGGGCTTTGTTCCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0067 67 AAATCGGTACACTTTTAGTAC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0068 68 CCCCTTGAAGTAGGGGGTTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0069 69 CTTGACTGAGCAAAGAAGTCA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0070 70 TTAATAATCAAATAATAAGAT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0071 71 CTTAGGAAGAAAAAGGCTCTT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0072 72 TTGAAAGAAAGACAAAACTTC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0073 73 TGTTCCTCGGATACAATTCGA (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0074 74 CTTTCGGGCGAGAAGCAGGCC (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0075 75 ACCAGTTCATATTTGGTTACT (((:::[[[:::))):::]]] Arabidopsis thaliana mitochondria >mitochondria 1-366924 mitochondria CHROMOSOME dumped from ADB: Apr/22/05 13:31 More ...
View RP0076 76 CGCTGAAACGGAGCGATATCCGT (((::::[[[[[))):::]]]]] X78602 peanut clump virus PKB-number: PKB33
Definition: tRNA-like structure 3'end pseudoknot of RNA1 of More ...
View RP0077 77 CCCTAACCGCGGGTAAGCGG (((:::[[[[))):::]]]] M25782 satellite tobacco mosaic virus PKB-number: PKB22 Definition: tRNA-like structure 3'end pseudoknot of satellit More ...
View RP0078 78 CCGTAACCGCCGGTAGCGG (((:::[[[[)))::]]]] M34077 tobacco mild green mosaic virus PKB-number: PKB23 Definition: tRNA-like structure 3'end pseudoknot of tobacco More ...
View RP0079 79 CCTTTACCCCGGGTATGGGG (((:::[[[[))):::]]]] X72586 paprika mild mottle virus PKB-number: PKB24 Definition: tRNA-like structure 3'end pseudoknot of paprika More ...
View RP0080 80 GGGGGGACTTAGCGCCCCCCAAACCGT ((((((:::::[[[))))))::::]]] AF033818 Bovine Leukemia Virus PKB-number: PKB1 Definition: Gag/pro ribosomal frameshift site of Bovine Leuke More ...
View RP0081 81 CGCGGCACCGTCCGCGGAACAAACGG (((((::[[[[)))))::::::]]]] X13063 Beet Western-Yellows Virus PKB-number: PKB2 Modification: 1999-6-21 Definition: Orf2-orf3 ribosomal f More ...
View RP0082 82 GGGGCTCAAGGGAGGCCCCAGAAACAAACTTTCCC ((((((:::[[[[))))))::::::::::::]]]] AF033820 Equine Infectious Anemic Virus PKB-number: PKB3 Definition: Gag-pol ribosomal frameshift site of Equine Infec More ...
View RP0083 83 GGGGCGAGCTGCAGCCCCAGTGAATCAAATGCAGC (((((::[[[[[[))))):::::::::::]]]]]] M25381 Feline Immunodeficiency Virus PKB-number: PKB4 Definition: Gag-pol ribosomal frameshift site of Feline Imm More ...
View RP0084 84 CCCCTCTTCCGAGGGTCATCGGA (((::::[[[[[))):::]]]]] X16378 turnip yellow mosaic virus PKB-number: PKB5
Definition: tRNA-like structure from turnip yellow mosaic More ...
View RP0085 85 CGTCTATCCTGGACGTCACCAGGA (((:::[[[[[[))):::]]]]]] AF035199 kennedya yellow mosaic virus PKB-number: PKB6
Definition: tRNA-like structure 3'end pseudoknot of kenned More ...
View PK0086 86 CGTCCTCCCGAACGTCATCGGGA (((::[[[[[[))):::]]]]]] X54354 cacao yellow mosaic virus PKB-number: PKB7 Definition: tRNA-like structure 3'end pseudoknot of cacao y More ...
View PK0087 87 CCCCCTTCCGTGGGTAACGGAA (((::[[[[[[)))::]]]]]] Y16104 physalis mottle virus PKB-number: PKB8
Definition: tRNA-like structure 3'end pseudoknot of physal More ...
View RP0088 88 CGTCTATCCTGGACGTCACCAGGA (((:::[[[[[[))):::]]]]]] AF035201 desmodium yellow mottle virus PKB-number: PKB9
Definition: tRNA-like structure 3'end pseudoknot of desmodiu More ...
View RP0089 89 CCCCTTTTCCGAGGGTATCGGAA (((:::[[[[[[)))::]]]]]] J04375 ononis yellow mosaic virus PKB-number: PKB10
Definition: tRNA-like structure 3'end pseudoknot of ononis More ...
View RP0090 90 CGTCCATCTCGAACGTCATCGAGA (((:::[[[[[[))):::]]]]]] AF035200 clitoria yellow vein virus PKB-number: PKB11
Definition: tRNA-like structure 3'end pseudoknot of clitori More ...
View RP0091 91 CCTCCCCCCGTAGGTTAACGGG (((:::[[[[[))):::]]]]] AF035633 wild cucumber mosaic virus PKB-number: PKB12 Definition: tRNA-like structure 3'end pseudoknot of wild cuc More ...
View RP0092 92 CGTCTATCCTGAACGTCATCAGGA (((:::[[[[[[))):::]]]]]] U91413 calopogonium yellow vein virus PKB-number: PKB13 Definition: tRNA-like structure 3'end pseudoknot of calopogo More ...
View RP0093 93 CCCCCTCCTGTGGGCTACAGGA (((::[[[[[[)))::]]]]]] AF035402 andean potato latent virus PKB-number: PKB14
Definition: tRNA-like structure 3'end pseudoknot of andean More ...
View RP0094 94 CCCCCTCCCGTGGGTCAACGGGA (((::[[[[[[))):::]]]]] J04374 eggplant mosaic virus PKB-number: PKB15
Definition: tRNA-like structure 3'end pseudoknot of eggplan More ...
View RP0095 95 CGCCCATCTCGAGCGTCATCGAGA (((:::[[[[[[))):::]]]]]] AF035202 okra mosaic virus PKB-number: PKB16
Definition: tRNA-like structure 3'end pseudoknot of okra mo More ...
View RP0096 96 CCCAAAACCCTGGGGATACAGGG (((::::[[[[[))):::]]]]] J02413 tobacco mosaic virus PKB-number: PKB17
Definition: tRNA-like structure 3'end pseudoknot of cowpea More ...
View RP0097 97 CCGTTACCCCCGGTAGGGG (((:::[[[[)))::]]]] J02415 tobacco mosaic virus PKB-number: PKB18
Definition: tRNA-like structure 3'end pseudoknot of tobacco More ...
View RP0098 98 CCCGAACCGCGGGTAGCGG (((:::[[[[)))::]]]] X72587 pepper mild mottle virus PKB-number: PKB19
Definition: tRNA-like structure 3'end pseudoknot of pepper More ...
View RP0099 99 CCTTTTCCCCGGGTAGGGG (((:::[[[[)))::]]]] D12505 cucumber green mottle mosaic virus PKB-number: PKB20
Definition: tRNA-like structure 3'end pseudoknot of cucumbe More ...
View RP0100 100 CCGGAACCCCCGGTTGGGG (((:::[[[[)))::]]]] X02144 tobacco mosaic virus PKB-number: PKB21
Definition: tRNA-like structure 3'end pseudoknot of the tom More ...
[ 1 2 3 4 5 6 7 ]